diff --git a/config.json b/config.json
index aae5770..743e90b 100644
--- a/config.json
+++ b/config.json
@@ -182,6 +182,14 @@
         "prerequisites": [],
         "difficulty": 2
       },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "8380e348-348c-4197-9cd4-34fd9c70c71b",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2
+      },
       {
         "slug": "pangram",
         "name": "Pangram",
diff --git a/exercises/practice/nucleotide-count/.docs/instructions.md b/exercises/practice/nucleotide-count/.docs/instructions.md
new file mode 100644
index 0000000..548d9ba
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.docs/instructions.md
@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
diff --git a/exercises/practice/nucleotide-count/.meta/config.json b/exercises/practice/nucleotide-count/.meta/config.json
new file mode 100644
index 0000000..7852581
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/config.json
@@ -0,0 +1,22 @@
+{
+  "authors": [
+    "BNAndras"
+  ],
+  "files": {
+    "solution": [
+      "src/lib.cairo"
+    ],
+    "test": [
+      "tests/nucleotide_count.cairo"
+    ],
+    "example": [
+      ".meta/example.cairo"
+    ],
+    "invalidator": [
+      "Scarb.toml"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}
diff --git a/exercises/practice/nucleotide-count/.meta/example.cairo b/exercises/practice/nucleotide-count/.meta/example.cairo
new file mode 100644
index 0000000..6fa00df
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/example.cairo
@@ -0,0 +1,30 @@
+#[derive(Debug, Default, Drop, PartialEq)]
+pub struct Counter {
+    pub a: u64,
+    pub c: u64,
+    pub g: u64,
+    pub t: u64
+}
+
+pub fn counts(strand: ByteArray) -> Counter {
+    let mut counter: Counter = Default::default();
+    let mut i = 0;
+
+    while i < strand.len() {
+        let chr = strand[i];
+        if chr == 'A' {
+            counter.a += 1;
+        } else if chr == 'C' {
+            counter.c += 1;
+        } else if chr == 'G' {
+            counter.g += 1;
+        } else if chr == 'T' {
+            counter.t += 1;
+        } else {
+            panic!("Invalid nucleotide in strand");
+        }
+        i += 1;
+    };
+
+    counter
+}
diff --git a/exercises/practice/nucleotide-count/.meta/tests.toml b/exercises/practice/nucleotide-count/.meta/tests.toml
new file mode 100644
index 0000000..7c55e53
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/tests.toml
@@ -0,0 +1,25 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"
diff --git a/exercises/practice/nucleotide-count/Scarb.toml b/exercises/practice/nucleotide-count/Scarb.toml
new file mode 100644
index 0000000..9ab2093
--- /dev/null
+++ b/exercises/practice/nucleotide-count/Scarb.toml
@@ -0,0 +1,7 @@
+[package]
+name = "nucleotide_count"
+version = "0.1.0"
+edition = "2024_07"
+
+[dev-dependencies]
+cairo_test = "2.7.1"
diff --git a/exercises/practice/nucleotide-count/src/lib.cairo b/exercises/practice/nucleotide-count/src/lib.cairo
new file mode 100644
index 0000000..1e9f32a
--- /dev/null
+++ b/exercises/practice/nucleotide-count/src/lib.cairo
@@ -0,0 +1,11 @@
+#[derive(Debug, Drop, PartialEq)]
+pub struct Counter {
+    pub a: u64,
+    pub c: u64,
+    pub g: u64,
+    pub t: u64
+}
+
+pub fn counts(strand: ByteArray) -> Counter {
+    panic!("implement `counts`")
+}
diff --git a/exercises/practice/nucleotide-count/tests/nucleotide_count.cairo b/exercises/practice/nucleotide-count/tests/nucleotide_count.cairo
new file mode 100644
index 0000000..804e3b3
--- /dev/null
+++ b/exercises/practice/nucleotide-count/tests/nucleotide_count.cairo
@@ -0,0 +1,43 @@
+use nucleotide_count::{counts, Counter};
+
+#[test]
+fn empty_strand() {
+    let strand = "";
+    let output = counts(strand);
+    let expected = Counter { a: 0, c: 0, g: 0, t: 0 };
+    assert_eq!(output, expected);
+}
+
+#[test]
+#[ignore]
+fn can_count_one_nucleotide_in_single_character_input() {
+    let strand = "G";
+    let output = counts(strand);
+    let expected = Counter { a: 0, c: 0, g: 1, t: 0 };
+    assert_eq!(output, expected);
+}
+
+#[test]
+#[ignore]
+fn strand_with_repeated_nucleotide() {
+    let strand = "GGGGGGG";
+    let output = counts(strand);
+    let expected = Counter { a: 0, c: 0, g: 7, t: 0 };
+    assert_eq!(output, expected);
+}
+
+#[test]
+#[ignore]
+fn strand_with_multiple_nucleotides() {
+    let strand = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
+    let output = counts(strand);
+    let expected = Counter { a: 20, c: 12, g: 17, t: 21 };
+    assert_eq!(output, expected);
+}
+
+#[test]
+#[ignore]
+#[should_panic(expected: ("Invalid nucleotide in strand",))]
+fn strand_with_invalid_nucleotides() {
+    counts("AGXXACT");
+}