From 49051bc09096d892445ff1c06a8c655351fc0a1c Mon Sep 17 00:00:00 2001 From: Kori Kuzma Date: Tue, 5 Nov 2024 08:23:07 -0500 Subject: [PATCH] test: re-run hgvs cassettes (#464) bioutils was recently updated, which caused tests to fail. this change updates the cassettes to get tests to pass close #462 --- ...NC_000013.11:g.32316467dup-expected5].yaml | 63 +++--- ....11:g.32331093_32331094dup-expected4].yaml | 153 +++++++------ ...s[NC_000013.11:g.32936732=-expected0].yaml | 24 +- ....10:g.289464_289465insCACA-expected8].yaml | 107 +++++---- ...0019.10:g.289485_289500del-expected9].yaml | 104 +++++---- ...vs[NM_001331029.1:c.722A>G-expected6].yaml | 56 +++-- ...hgvs[NM_181798.1:c.1007G>T-expected7].yaml | 75 +++--- .../extras/cassettes/test_rle_seq_limit.yaml | 214 +++++++++--------- 8 files changed, 435 insertions(+), 361 deletions(-) diff --git a/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32316467dup-expected5].yaml b/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32316467dup-expected5].yaml index 82cd0c36..6999d7bf 100644 --- a/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32316467dup-expected5].yaml +++ b/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32316467dup-expected5].yaml @@ -23,9 +23,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:42 GMT + - Tue, 05 Nov 2024 04:24:17 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -53,9 +53,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:42 GMT + - Tue, 05 Nov 2024 04:24:17 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -83,9 +83,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:42 GMT + - Tue, 05 Nov 2024 04:24:17 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -113,9 +113,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:42 GMT + - Tue, 05 Nov 2024 04:24:17 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -143,9 +143,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:42 GMT + - Tue, 05 Nov 2024 04:24:17 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -164,9 +164,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32316467&seq_stop=32316467&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NDMxMzc10YQ8EjPzdfoTixIDM1r1ghOaMIyC3Oz01V - MDTWUXAPcs4wttArMDRRCCjKzE0sqlRwLC5OzU3KqeRy5OICAAAA//8DABNU0u5bAAAA + string: '>NC_000013.11:32316467-32316467 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + A + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -183,20 +187,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:42 GMT + - Tue, 05 Nov 2024 04:24:17 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500004C64A04EB157.1.1.m_5 + - 322C9169F7233CA500008001A2F50B2E.1.1.m_5 NCBI-SID: - - 449331F7EE6FB74F_EC24SID + - D84C9681EF2B137C_78C5SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=449331F7EE6FB74F_EC24SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:42 GMT + - ncbi_sid=D84C9681EF2B137C_78C5SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:17 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -204,7 +208,7 @@ interactions: X-RateLimit-Limit: - '3' X-RateLimit-Remaining: - - '1' + - '2' X-UA-Compatible: - IE=Edge X-XSS-Protection: @@ -229,10 +233,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32316467&seq_stop=32316487&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NDMxMzc10Iw8JcwSM/N1+hOLEgMzWvWCE5owjILc7P - TVUwNNZRcA9yzjC20CswNFEIKMrMTSyqVHAsLk7NTcqp5HIMCXF3dwxxdnZ0dHQHQXcgk4sLAAAA - //8DAG14V2hvAAAA + string: '>NC_000013.11:32316467-32316487 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + ATTGGATCCAAAGAGAGGCCA + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -249,20 +256,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:42 GMT + - Tue, 05 Nov 2024 04:24:18 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500005164A2D62050.1.1.m_5 + - D0BD5FC90C0C9E5500003D05FA009012.1.1.m_5 NCBI-SID: - - 522413927AFDEB32_BA92SID + - 5A70B3B62676069A_B554SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=522413927AFDEB32_BA92SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:42 GMT + - ncbi_sid=5A70B3B62676069A_B554SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:18 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: diff --git a/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32331093_32331094dup-expected4].yaml b/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32331093_32331094dup-expected4].yaml index 5d200cb7..a34c128b 100644 --- a/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32331093_32331094dup-expected4].yaml +++ b/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32331093_32331094dup-expected4].yaml @@ -23,9 +23,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -53,9 +53,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -83,9 +83,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -113,9 +113,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -143,9 +143,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -173,9 +173,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -203,9 +203,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -233,9 +233,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -263,9 +263,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -293,9 +293,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -323,9 +323,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -353,9 +353,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -383,9 +383,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -413,9 +413,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:39 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -443,9 +443,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:40 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -473,9 +473,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:40 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -503,9 +503,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:40 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -533,9 +533,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:40 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -554,9 +554,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32331083&seq_stop=32331094&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NjQwMLY10Iw9JEwSM/N1+hOLEgMzWvWCE5owjILc7P - TVUwNNZRcA9yzjC20CswNFEIKMrMTSyqVHAsLk7NTcqp5ApBAlxcAAAAAP//AwBz5s6GZgAAAA== + string: '>NC_000013.11:32331083-32331094 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + TTTTTTTTTTTT + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -573,20 +577,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:40 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500003264952754B0.1.1.m_5 + - D0BD5FC90C0C9E55000046058658C914.1.1.m_5 NCBI-SID: - - 5B5E8A1491FD253E_06B4SID + - D638653620E1943D_1DE7SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=5B5E8A1491FD253E_06B4SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:40 GMT + - ncbi_sid=D638653620E1943D_1DE7SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:33 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -619,9 +623,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32331094&seq_stop=32331094&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NjQwNLE10YQ8EjPzdfoTixIDM1r1ghOaMIyC3Oz01V - MDTWUXAPcs4wttArMDRRCCjKzE0sqlRwLC5OzU3KqeQK4eICAAAA//8DAOcxeKNbAAAA + string: '>NC_000013.11:32331094-32331094 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + T + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -638,20 +646,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:40 GMT + - Tue, 05 Nov 2024 04:23:33 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 322C2168844ED525000028623B1F8AEC.1.1.m_5 + - D0BD5FC90C0C9E5500004905884C00F7.1.1.m_5 NCBI-SID: - - EC9D743D7453E637_C7F5SID + - 25C0678DF76DD696_BEDDSID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=EC9D743D7453E637_C7F5SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:40 GMT + - ncbi_sid=25C0678DF76DD696_BEDDSID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:34 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -684,10 +692,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32331083&seq_stop=32331114&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NjQwMLY10ww9DQRMEjPzdfoTixIDM1r1ghOaMIyC3O - z01VMDTWUXAPcs4wttArACoLKMrMTSyqVHAsLk7NTcqp5ApBAu6O7u4h7kAyxBnIcQaS7iFcXAAA - AAD//wMAlOTJvHoAAAA= + string: '>NC_000013.11:32331083-32331114 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + TTTTTTTTTTTTGAGGTGGAGTCTTGCTCTGT + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -704,20 +715,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:41 GMT + - Tue, 05 Nov 2024 04:23:34 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 322C2168844ED52500003A623DA02599.1.1.m_5 + - D0BD5FC90C0C9E550000410589B0B27B.1.1.m_5 NCBI-SID: - - F67060DC297FDC2E_6A0ESID + - 26A4A0218EA2B845_8682SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=F67060DC297FDC2E_6A0ESID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:41 GMT + - ncbi_sid=26A4A0218EA2B845_8682SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:34 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -750,9 +761,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32331093&seq_stop=32331094&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NjQwNLY10ow0TBIz83X6E4sSAzNa9YITmjCMgtzs9N - VTA01lFwD3LOMLbQKzA0UQgoysxNLKpUcCwuTs1NyqnkCgnh4gIAAAD//wMAmBgGAVwAAAA= + string: '>NC_000013.11:32331093-32331094 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + TT + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -769,20 +784,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:41 GMT + - Tue, 05 Nov 2024 04:23:34 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 322C2168844ED52500002762404BF5C7.1.1.m_5 + - D0BD5FC90C0C9E5500002A058B7CF6D7.1.1.m_5 NCBI-SID: - - CC7258C6BEBE92B7_B633SID + - 55D2BECDA262676D_5026SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=CC7258C6BEBE92B7_B633SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:41 GMT + - ncbi_sid=55D2BECDA262676D_5026SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:35 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: diff --git a/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32936732=-expected0].yaml b/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32936732=-expected0].yaml index 7e6ed4af..3886fcca 100644 --- a/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32936732=-expected0].yaml +++ b/tests/extras/cassettes/test_hgvs[NC_000013.11:g.32936732=-expected0].yaml @@ -23,9 +23,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:35 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -44,9 +44,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32936732&seq_stop=32936732&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDYz1DQytjI0tjM3NjI10YQ8EjPzdfoTixIDM1r1ghOaMIyC3Oz01V - MDTWUXAPcs4wttArMDRRCCjKzE0sqlRwLC5OzU3KqeRy5uICAAAA//8DALFcilZbAAAA + string: '>NC_000013.11:32936732-32936732 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + C + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -63,20 +67,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:35 GMT + - Tue, 05 Nov 2024 04:23:32 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500005C647A219942.1.1.m_5 + - D0BD5FC90C0C9E5500003205841B3DF3.1.1.m_5 NCBI-SID: - - 0F837A16B6853FBD_220BSID + - 61D5418A7BF867D6_A080SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=0F837A16B6853FBD_220BSID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:35 GMT + - ncbi_sid=61D5418A7BF867D6_A080SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:32 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: diff --git a/tests/extras/cassettes/test_hgvs[NC_000019.10:g.289464_289465insCACA-expected8].yaml b/tests/extras/cassettes/test_hgvs[NC_000019.10:g.289464_289465insCACA-expected8].yaml index b018e59d..559708bb 100644 --- a/tests/extras/cassettes/test_hgvs[NC_000019.10:g.289464_289465insCACA-expected8].yaml +++ b/tests/extras/cassettes/test_hgvs[NC_000019.10:g.289464_289465insCACA-expected8].yaml @@ -23,9 +23,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:46 GMT + - Tue, 05 Nov 2024 04:23:36 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -53,9 +53,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:46 GMT + - Tue, 05 Nov 2024 04:23:36 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -83,9 +83,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:46 GMT + - Tue, 05 Nov 2024 04:23:36 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -113,9 +113,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:46 GMT + - Tue, 05 Nov 2024 04:23:36 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -143,9 +143,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:46 GMT + - Tue, 05 Nov 2024 04:23:36 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -173,9 +173,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:46 GMT + - Tue, 05 Nov 2024 04:23:36 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -194,9 +194,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000019.10&rettype=fasta&seq_start=289465&seq_stop=289466&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDSz1DAysjC0sTM1NdMGWm4JGfm69QnFiQmZpXrJCcUQTkFufnpioY - WuoouAc5Zxhb6BUYmigEFGXmJhZVKjgWF6fmJuVUcjk7cnEBAAAA//8DAN6im+lYAAAA + string: '>NC_000019.10:289465-289466 Homo sapiens chromosome 19, GRCh38.p14 + Primary Assembly + + CA + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -213,20 +217,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:46 GMT + - Tue, 05 Nov 2024 04:23:36 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500004164B5C5CA50.1.1.m_5 + - D0BD5FC90C0C9E550000520590057FCC.1.1.m_5 NCBI-SID: - - 23518C7A3ED150B5_B224SID + - 2523A9E792D7BCD4_0E8ESID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=23518C7A3ED150B5_B224SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:46 GMT + - ncbi_sid=2523A9E792D7BCD4_0E8ESID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:36 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -234,7 +238,7 @@ interactions: X-RateLimit-Limit: - '3' X-RateLimit-Remaining: - - '1' + - '2' X-UA-Compatible: - IE=Edge X-XSS-Protection: @@ -259,9 +263,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000019.10&rettype=fasta&seq_start=289466&seq_stop=289466&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDSz1DAysjC0sTMzNdCKXgkZ+br1CcWJCZmleskJxRBOQW5+emKhha - 6ii4BzlnGFvoFRiaKAQUZeYmFlUqOBYXp+Ym5VRyOXJxAQAAAP//AwDscSJIVwAAAA== + string: '>NC_000019.10:289466-289466 Homo sapiens chromosome 19, GRCh38.p14 + Primary Assembly + + A + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -278,20 +286,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:47 GMT + - Tue, 05 Nov 2024 04:23:36 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 322C2168844ED525000033625B3DB0E4.1.1.m_5 + - D0BD5FC90C0C9E550000470592B56B94.1.1.m_5 NCBI-SID: - - 2EFCCFA110F2FAAD_83DASID + - DA6D1EFA76ED60B1_7328SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=2EFCCFA110F2FAAD_83DASID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:47 GMT + - ncbi_sid=DA6D1EFA76ED60B1_7328SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:37 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -324,10 +332,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000019.10&rettype=fasta&seq_start=289465&seq_stop=289486&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDSz1DAysjC0sTM1NdEGVhpuCRn5uvUJxYkJmaV6yQnFEE5Bbn56Yq - GFrqKLgHOWcYW+gVGJooBBRl5iYWVSo4Fhen5iblVHI5O7o7OzqHhIS4u7s7urs7O4NJLi4AAAAA - //8DAME0cP1sAAAA + string: '>NC_000019.10:289465-289486 Homo sapiens chromosome 19, GRCh38.p14 + Primary Assembly + + CAGCACTTTGGGAGGCCGAGGC + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -344,20 +355,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:47 GMT + - Tue, 05 Nov 2024 04:23:37 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500002564BA070495.1.1.m_5 + - D0BD5FC90C0C9E550000610594B56557.1.1.m_5 NCBI-SID: - - A4BFD55E738F1983_7D6BSID + - BF22CB9310A025DE_6D3FSID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=A4BFD55E738F1983_7D6BSID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:47 GMT + - ncbi_sid=BF22CB9310A025DE_6D3FSID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:37 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -390,9 +401,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000019.10&rettype=fasta&seq_start=289463&seq_stop=289466&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDSz1DAysjC0sTM2NdMGWm4JGfm69QnFiQmZpXrJCcUQTkFufnpioY - WuoouAc5Zxhb6BUYmigEFGXmJhZVKjgWF6fmJuVUcjmHODtycQEAAAD//wMAcnFU/1oAAAA= + string: '>NC_000019.10:289463-289466 Homo sapiens chromosome 19, GRCh38.p14 + Primary Assembly + + CTCA + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -409,20 +424,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:38 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 322C2168844ED52500004B6261A52076.1.1.m_5 + - D0BD5FC90C0C9E550000340597697E94.1.1.m_5 NCBI-SID: - - 4D83F50ED8EB562C_4BE4SID + - AA00BBF35F9996C5_F848SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=4D83F50ED8EB562C_4BE4SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:48 GMT + - ncbi_sid=AA00BBF35F9996C5_F848SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:38 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: diff --git a/tests/extras/cassettes/test_hgvs[NC_000019.10:g.289485_289500del-expected9].yaml b/tests/extras/cassettes/test_hgvs[NC_000019.10:g.289485_289500del-expected9].yaml index 11b1b06f..f547d566 100644 --- a/tests/extras/cassettes/test_hgvs[NC_000019.10:g.289485_289500del-expected9].yaml +++ b/tests/extras/cassettes/test_hgvs[NC_000019.10:g.289485_289500del-expected9].yaml @@ -23,9 +23,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -53,9 +53,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -83,9 +83,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -113,9 +113,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -143,9 +143,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -173,9 +173,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -203,9 +203,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -233,9 +233,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -263,9 +263,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -293,9 +293,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:48 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -314,10 +314,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000019.10&rettype=fasta&seq_start=289481&seq_stop=289501&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDSz1DAysjC0sTC0NdIGVqYKjgkZ+br1CcWJCZmleskJxRBOQW5+em - Khha6ii4BzlnGFvoFRiaKAQUZeYmFlUqOBYXp+Ym5VRyObs7urs7uwOxo7tjiLMjmM/FBQAAAP// - AwCUo69uawAAAA== + string: '>NC_000019.10:289481-289501 Homo sapiens chromosome 19, GRCh38.p14 + Primary Assembly + + CGAGGCGGGCAGATCACGAGG + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -334,20 +337,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:49 GMT + - Tue, 05 Nov 2024 04:23:08 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500002F64BFD27CCF.1.1.m_5 + - 322C9169F7233CA500005D0143F94E5F.1.1.m_5 NCBI-SID: - - 7C248705796F8474_4DADSID + - 3813F3C298A098FB_4107SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=7C248705796F8474_4DADSID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:49 GMT + - ncbi_sid=3813F3C298A098FB_4107SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:09 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -355,7 +358,7 @@ interactions: X-RateLimit-Limit: - '3' X-RateLimit-Remaining: - - '1' + - '2' X-UA-Compatible: - IE=Edge X-XSS-Protection: @@ -380,9 +383,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000019.10&rettype=fasta&seq_start=289501&seq_stop=289501&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDSz1DAysjC0tTA0NdCKXgkZ+br1CcWJCZmleskJxRBOQW5+emKhha - 6ii4BzlnGFvoFRiaKAQUZeYmFlUqOBYXp+Ym5VRyuXNxAQAAAP//AwDTOp6eVwAAAA== + string: '>NC_000019.10:289501-289501 Homo sapiens chromosome 19, GRCh38.p14 + Primary Assembly + + G + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -399,20 +406,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:49 GMT + - Tue, 05 Nov 2024 04:23:10 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 939B9BD7E3BE00F500003D40A5524158.1.1.m_5 + - 322C9169F7233CA5000063014578CCFE.1.1.m_5 NCBI-SID: - - 9386A08F08A7F5B8_F5CFSID + - 2B8752BE15CBE8F5_905BSID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=9386A08F08A7F5B8_F5CFSID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:49 GMT + - ncbi_sid=2B8752BE15CBE8F5_905BSID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:10 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -445,10 +452,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000019.10&rettype=fasta&seq_start=289481&seq_stop=289521&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAAByHwQqDQAxE7/sV+YAqRi3s9lAIOaSnUsR7sWVBwe3K5uTfNzow8+bdn/xuLBhq - bG6tD73HynBtER45ZdBpW+JP4TsXU80pAoYLyMBz5+sNe3iVJU1lB1KN6bPujoVEWKwkNDKdbhQ5 - /VhmO+zcHwAA//8DAPeNIyZ/AAAA + string: '>NC_000019.10:289481-289521 Homo sapiens chromosome 19, GRCh38.p14 + Primary Assembly + + CGAGGCGGGCAGATCACGAGGTCAGGAGATCGAGACCATCC + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -465,20 +475,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:23:10 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 322C2168844ED52500002B62673134C8.1.1.m_5 + - 322C9169F7233CA500006701472356C3.1.1.m_5 NCBI-SID: - - 859EB8A2A2C4C9A8_F275SID + - 75EFE90348A18523_C287SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=859EB8A2A2C4C9A8_F275SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:50 GMT + - ncbi_sid=75EFE90348A18523_C287SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:23:10 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: diff --git a/tests/extras/cassettes/test_hgvs[NM_001331029.1:c.722A>G-expected6].yaml b/tests/extras/cassettes/test_hgvs[NM_001331029.1:c.722A>G-expected6].yaml index 6d8b72d1..2ee2f649 100644 --- a/tests/extras/cassettes/test_hgvs[NM_001331029.1:c.722A>G-expected6].yaml +++ b/tests/extras/cassettes/test_hgvs[NM_001331029.1:c.722A>G-expected6].yaml @@ -28,9 +28,9 @@ interactions: Content-Type: - application/json Date: - - Wed, 26 Jun 2024 11:58:43 GMT + - Tue, 05 Nov 2024 04:24:18 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -49,10 +49,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NM_001331029.1&rettype=fasta&seq_start=872&seq_stop=872&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAAAzGsQrCMBAG4D1P8Y8KVXLpYHUQ6uRiCX0BOSXYQJuE3FXw7e3wwXcdHk9rqW3J - uvORLt3JHTa45yVDuMSQBKVmDTGhTFnKxMoSQKjhs86suf4g62tNUUHuhp33nsZt+wZaOcm7xqL4 - co2cFF2DZRx60xvzBwAA//8DADLRQFd8AAAA + string: '>NM_001331029.1:872-872 Homo sapiens protein phosphatase 1 regulatory + subunit 12B (PPP1R12B), transcript variant 8, mRNA + + A + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -69,20 +72,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:43 GMT + - Tue, 05 Nov 2024 04:24:18 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 322C2168844ED5250000296249020435.1.1.m_5 + - D0BD5FC90C0C9E5500004F05FBFB7A74.1.1.m_5 NCBI-SID: - - 6387644963D1849D_457DSID + - D8704C96D061E458_F364SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=6387644963D1849D_457DSID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:43 GMT + - ncbi_sid=D8704C96D061E458_F364SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:19 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -129,9 +132,9 @@ interactions: Content-Type: - application/json Date: - - Wed, 26 Jun 2024 11:58:43 GMT + - Tue, 05 Nov 2024 04:24:19 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -159,9 +162,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:43 GMT + - Tue, 05 Nov 2024 04:24:19 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -180,10 +183,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NM_001331029.1&rettype=fasta&seq_start=872&seq_stop=892&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAAAzGsQrCMBQF0L1fcUeFKk062DoIsUNdLKFkl6cEG7BJSF4E/95O51ym+6NpRNuK - RvZHce5O8tD1ErewBmSKzvqMmAJb5xGXkONCTNlCINl3+RCH9EMuz+IdQ8grdlprMW/b1+BEPr+S - i4wvJUee0dVY50lVyoxKDWZQW8zGOCpjquoPAAD//wMAQOE1ipAAAAA= + string: '>NM_001331029.1:872-892 Homo sapiens protein phosphatase 1 regulatory + subunit 12B (PPP1R12B), transcript variant 8, mRNA + + ATGAACTCAATGTTCAGGATT + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -200,20 +206,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:44 GMT + - Tue, 05 Nov 2024 04:24:20 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 322C2168844ED52500004B624D2E170E.1.1.m_5 + - D0BD5FC90C0C9E5500005D05FE75DCD1.1.1.m_5 NCBI-SID: - - CB5784147FC0F267_B834SID + - B75D46DA90AB6D72_06CBSID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=CB5784147FC0F267_B834SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:44 GMT + - ncbi_sid=B75D46DA90AB6D72_06CBSID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:20 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -221,7 +227,7 @@ interactions: X-RateLimit-Limit: - '3' X-RateLimit-Remaining: - - '1' + - '2' X-UA-Compatible: - IE=Edge X-XSS-Protection: diff --git a/tests/extras/cassettes/test_hgvs[NM_181798.1:c.1007G>T-expected7].yaml b/tests/extras/cassettes/test_hgvs[NM_181798.1:c.1007G>T-expected7].yaml index 5b4b2f1a..79b84537 100644 --- a/tests/extras/cassettes/test_hgvs[NM_181798.1:c.1007G>T-expected7].yaml +++ b/tests/extras/cassettes/test_hgvs[NM_181798.1:c.1007G>T-expected7].yaml @@ -28,9 +28,9 @@ interactions: Content-Type: - application/json Date: - - Wed, 26 Jun 2024 11:58:44 GMT + - Tue, 05 Nov 2024 04:24:20 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -49,10 +49,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NM_181798.1&rettype=fasta&seq_start=1263&seq_stop=1263&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAABTEQQrCMBAF0H1O8ZcKrTAVtLoQxIWCGKgXkGlNayCThCQteHvxLd5JP17U0v7Q - buhIzW5b/8MtSEDmaI3PiKFwznYWLMEVnkw9cTFvDB/23jjkuR9ZrPuigxjpTQJhdb/ojtYVSmKf - h2RjwcLJsi9oKshTn9VVqR8AAAD//wMAjtT/qIAAAAA= + string: '>NM_181798.1:1263-1263 Homo sapiens potassium voltage-gated channel + subfamily Q member 1 (KCNQ1), transcript variant 2, mRNA + + G + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -69,20 +72,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:44 GMT + - Tue, 05 Nov 2024 04:24:20 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500004D64AC6A4344.1.1.m_5 + - 322C9169F7233CA500005201A58BB4F4.1.1.m_5 NCBI-SID: - - 51E2D31E48C2B505_B80ESID + - 0D5641C9CB27706A_9DF4SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=51E2D31E48C2B505_B80ESID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:44 GMT + - ncbi_sid=0D5641C9CB27706A_9DF4SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:21 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -129,9 +132,9 @@ interactions: Content-Type: - application/json Date: - - Wed, 26 Jun 2024 11:58:45 GMT + - Tue, 05 Nov 2024 04:24:21 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -159,9 +162,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:45 GMT + - Tue, 05 Nov 2024 04:24:21 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -180,10 +183,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NR_040711.1&rettype=fasta&seq_start=1263&seq_stop=1263&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAABTEsQrCMBQF0L1fcUeFRJoqCg6COCgUCi3u8lqfNZi8lCQt+PfiGc6p6R7lrjwY - szFHU+23+h9uwQckmixLwhQypWRnjyW4TCPrkTI/MbxJhJ1C3d61sx9GmvsXeeu+Cp59zxEGq/rS - tGatkCNJGqKdMhaKliSjUpAgeghPKyO65lxci+IHAAD//wMAKt9ZTJMAAAA= + string: '>NR_040711.1:1263-1263 Homo sapiens potassium voltage-gated channel, + KQT-like subfamily, member 1 (KCNQ1), transcript variant 2, non-coding RNA + + G + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -200,20 +206,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:45 GMT + - Tue, 05 Nov 2024 04:24:21 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500002F64AEE6BE2F.1.1.m_5 + - D0BD5FC90C0C9E5500002306006D0145.1.1.m_5 NCBI-SID: - - B9D9C994B2D9D967_EAC1SID + - 474459F9CA51DF89_0363SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=B9D9C994B2D9D967_EAC1SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:45 GMT + - ncbi_sid=474459F9CA51DF89_0363SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:21 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -246,10 +252,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NM_181798.1&rettype=fasta&seq_start=1263&seq_stop=1268&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAAAzEuwrCMBgG0D1P8Y0KrZAKGh0E6VBBDFSyy9+a1kBuJGnBt9cznIt8vLjgx5PY - 8TNvDvv6n8AtuIBM0WifEUOhnM3isAZbaNb1TEW/MX7Ie22Rl2EiZ+wXPZx2g07g2Nxb2fNthZLI - 5zGZWLBSMuQLmgruKa+sU6pVHWM/AAAA//8DAATZgc6FAAAA + string: '>NM_181798.1:1263-1268 Homo sapiens potassium voltage-gated channel + subfamily Q member 1 (KCNQ1), transcript variant 2, mRNA + + GTTCTG + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -266,20 +275,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:45 GMT + - Tue, 05 Nov 2024 04:24:21 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500005E64B2C02582.1.1.m_5 + - D0BD5FC90C0C9E5500004A0601FB0EB1.1.1.m_5 NCBI-SID: - - 9B77F01479EAA535_E7D3SID + - 253B71D3BC16CA7C_FBDASID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=9B77F01479EAA535_E7D3SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:46 GMT + - ncbi_sid=253B71D3BC16CA7C_FBDASID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:22 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: diff --git a/tests/extras/cassettes/test_rle_seq_limit.yaml b/tests/extras/cassettes/test_rle_seq_limit.yaml index d6c51115..72d1a230 100644 --- a/tests/extras/cassettes/test_rle_seq_limit.yaml +++ b/tests/extras/cassettes/test_rle_seq_limit.yaml @@ -23,9 +23,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -53,9 +53,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -83,9 +83,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -113,9 +113,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -143,9 +143,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -173,9 +173,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -203,9 +203,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -233,9 +233,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -263,9 +263,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -293,9 +293,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -323,9 +323,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -353,9 +353,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -383,9 +383,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -413,9 +413,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -443,9 +443,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -473,9 +473,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -503,9 +503,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -533,9 +533,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -563,9 +563,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -593,9 +593,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -623,9 +623,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -653,9 +653,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -683,9 +683,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -713,9 +713,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -743,9 +743,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -773,9 +773,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -803,9 +803,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -833,9 +833,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -863,9 +863,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -893,9 +893,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -923,9 +923,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -953,9 +953,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -983,9 +983,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1013,9 +1013,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1043,9 +1043,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1073,9 +1073,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:51 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1103,9 +1103,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:51 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1133,9 +1133,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:51 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1163,9 +1163,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:51 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1193,9 +1193,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:51 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1223,9 +1223,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:51 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1253,9 +1253,9 @@ interactions: Content-Type: - text/plain; charset=utf-8 Date: - - Wed, 26 Jun 2024 11:58:51 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Server: - - Werkzeug/2.2.2 Python/3.10.4 + - Werkzeug/2.2.3 Python/3.10.12 status: code: 200 message: OK @@ -1274,10 +1274,13 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32331043&seq_stop=32331094&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAALLzc443AAJDYz1DQytjI2NjQwMTY10Iw9JEwSM/N1+hOLEgMzWvWCE5owjILc7P - TVUwNNZRcA9yzjC20CswNFEIKMrMTSyqVHAsLk7NTcqp5AoJCXF0Dwlxd3R0DnF0dnQHssHAHQmB - pEOQABcXAAAA//8DAN0Jx5SOAAAA + string: '>NC_000013.11:32331043-32331094 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + TTTAGTTGAACTACAGGTTTTTTTGTTGTTGTTGTTTTGATTTTTTTTTTTT + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -1294,20 +1297,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:50 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - 939B9BD7E3BE00F500003B40A7D378C5.1.1.m_5 + - 322C9169F7233CA500006001A90E0E8C.1.1.m_5 NCBI-SID: - - F2074185F72DD742_7BFBSID + - 349C45CA2FB19D74_77FFSID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=F2074185F72DD742_7BFBSID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:51 GMT + - ncbi_sid=349C45CA2FB19D74_77FFSID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:23 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: @@ -1315,7 +1318,7 @@ interactions: X-RateLimit-Limit: - '3' X-RateLimit-Remaining: - - '1' + - '2' X-UA-Compatible: - IE=Edge X-XSS-Protection: @@ -1340,10 +1343,15 @@ interactions: uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NC_000013.11&rettype=fasta&seq_start=32331043&seq_stop=32331114&tool=bioutils&email=biocommons-dev@googlegroups.com response: body: - string: !!binary | - H4sIAAAAAAAAAEyKsQrDMAxEd3+FPqAJUZWhdCgIDepUStBe0mJIoK6DPeXvq2TK4zjuuLs95NU5 - SC3ilc5E2PXU7AGxh3tOGeq4zPFX4TMVrzWnCEgn0EEmurSL355lTmNZgWuN6f1dg5mxmimzGAur - 5x09aJvtgG43dTfxIu5BLYQ/AAAA//8DAGgcIEKjAAAA + string: '>NC_000013.11:32331043-32331114 Homo sapiens chromosome 13, GRCh38.p14 + Primary Assembly + + TTTAGTTGAACTACAGGTTTTTTTGTTGTTGTTGTTTTGATTTTTTTTTTTTGAGGTGGAGTCTTGCTCT + + GT + + + ' headers: Access-Control-Allow-Origin: - '*' @@ -1360,20 +1368,20 @@ interactions: Content-Type: - text/plain Date: - - Wed, 26 Jun 2024 11:58:51 GMT + - Tue, 05 Nov 2024 04:24:23 GMT Keep-Alive: - timeout=4, max=40 NCBI-PHID: - - D0BDC04CDF84FC0500004A64CEF8EC74.1.1.m_5 + - 322C9169F7233CA500006001A9C33C21.1.1.m_5 NCBI-SID: - - 270365131F469F9A_AE40SID + - 7FBADDA6937007AC_F236SID Referrer-Policy: - origin-when-cross-origin Server: - Finatra Set-Cookie: - - ncbi_sid=270365131F469F9A_AE40SID; domain=.nih.gov; path=/; expires=Thu, 26 - Jun 2025 11:58:51 GMT + - ncbi_sid=7FBADDA6937007AC_F236SID; domain=.nih.gov; path=/; expires=Wed, 05 + Nov 2025 04:24:24 GMT Strict-Transport-Security: - max-age=31536000; includeSubDomains; preload Transfer-Encoding: