Skip to content

Latest commit

 

History

History
25 lines (14 loc) · 1.33 KB

README.md

File metadata and controls

25 lines (14 loc) · 1.33 KB

CrispyScraper

Electron app that scrapes multiple sites and find the most relevant results

Installation Directions

If npm isn't installed on your computer, install npm/node. [https://www.npmjs.com/get-npm]

unzip and move into the CrispyFinder-1.0.2 folder (With the README file) in your terminal using the cd command (ex. cd CrispyFinder-1.0.2)

run "npm i" to install all the necessary dependencies

run "npm start" to launch the app.

in order to build the app and create an executable, run "npm i npm install electron-packager --save-dev" [https://github.com/electron/electron-packager]

Then follow the instructions at the top of app.js:

comment out the testing code, uncomment code for building, and run "electron-packager ./ app-name"

try running a sample sequence like this one: atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaagctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgccaggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccacaggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaacacctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctcccatgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggatggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatgcattagcacaacaggcctttgaagaggctcggagaaggacacgcgaatttgaagatagagacaggtctcatcgggaggaaatggaggcaagaagacaacaagaccctagtcctggttccaatttaggtggtggtgatgacctcaaacttcgttaa