config.yaml

########################################################################################################
# Run settings
########################################################################################################

## ~~~~~ sample sheet ~~~~~
### See `example_sample_sheet.csv` for details
# SAMPLE_SHEET_PATH: data/test_sample_sheet.csv # toy data, lots of recipes
SAMPLE_SHEET_PATH: data/test_sample_sheet_minimal.csv # toy data, just 1 recipe each

# Resource parameters
CORES: 8               # how many cores to give each process
MEMLIMIT: 121916827066  # limit in bytes  
MEMLIMIT_MB: 256000     # limit in megabytes
MEMLIMIT_GB: 200G       # mem limit for kallisto

# Recipe details (whitelists, barcode/UMI design, etc.)
RECIPE_SHEET: resources/recipe_sheet.csv

########################################################################################################
# Important directory file paths
########################################################################################################
# **Change these paths for where you want temporary (TMPDIR) and output (OUTDIR) files
TMPDIR: tmp
OUTDIR: out

########################################################################################################
# Resources - file paths
########################################################################################################
FASTQC_ADAPTERS: resources/fastqc_adapters.txt 
BLASTDB: /shared_data/genome_db/BLAST_NCBI # path to where the nt BLAST database is stored
MIRGE_LIB: resources/miRge3_Lib

########################################################################################################
# Library details
########################################################################################################
# R1_PRIMER: "CTACACGACGCTCTTCCGATCT" # R1 primer (used in Visium & Seeker)
MAX_SHORT_READ_LENGTH: 34 # max read length for reads to be aligned to short RNA references