diff --git a/README.md b/README.md
index 50e94346..ccb136f0 100644
--- a/README.md
+++ b/README.md
@@ -6,7 +6,7 @@
 </h1>
 
 [![GitHub Actions CI Status](https://github.com/nf-core/smrnaseq/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/smrnaseq/actions/workflows/ci.yml)
-[![GitHub Actions Linting Status](https://github.com/nf-core/smrnaseq/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/smrnaseq/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/smrnaseq/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)
+[![GitHub Actions Linting Status](https://github.com/nf-core/smrnaseq/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/smrnaseq/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/smrnaseq/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.10696391?labelColor=000000)](https://doi.org/10.5281/zenodo.10696391)
 [![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)
 
 [![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/)
diff --git a/modules.json b/modules.json
index 1d31a680..109997b3 100644
--- a/modules.json
+++ b/modules.json
@@ -17,12 +17,12 @@
                     },
                     "fastp": {
                         "branch": "master",
-                        "git_sha": "003920c7f9a8ae19b69a97171922880220bedf56",
+                        "git_sha": "95cf5fe0194c7bf5cb0e3027a2eb7e7c89385080",
                         "installed_by": ["fastq_fastqc_umitools_fastp", "modules"]
                     },
                     "fastqc": {
                         "branch": "master",
-                        "git_sha": "f4ae1d942bd50c5c0b9bd2de1393ce38315ba57c",
+                        "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd",
                         "installed_by": ["fastq_fastqc_umitools_fastp"]
                     },
                     "multiqc": {
@@ -57,12 +57,12 @@
                     },
                     "umicollapse": {
                         "branch": "master",
-                        "git_sha": "ba3f3df395d2719dcef5c67189042a1dc555c701",
+                        "git_sha": "b97197968ac12dde2463fa54541f6350c46f2035",
                         "installed_by": ["modules"]
                     },
                     "umitools/extract": {
                         "branch": "master",
-                        "git_sha": "ff7e93715a2acecf3f143ec78c9858deba2984d0",
+                        "git_sha": "d2c5e76f291379f3dd403e48e46ed7e6ba5da744",
                         "installed_by": ["fastq_fastqc_umitools_fastp", "modules"]
                     },
                     "untarfiles": {
@@ -86,7 +86,7 @@
                     },
                     "fastq_fastqc_umitools_fastp": {
                         "branch": "master",
-                        "git_sha": "003920c7f9a8ae19b69a97171922880220bedf56",
+                        "git_sha": "cabcc0dadf8366aa7a9930066a7b3dd90d9825d5",
                         "installed_by": ["subworkflows"]
                     },
                     "utils_nextflow_pipeline": {
diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf
index 2a3b679e..4fc19b74 100644
--- a/modules/nf-core/fastp/main.nf
+++ b/modules/nf-core/fastp/main.nf
@@ -29,7 +29,7 @@ process FASTP {
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
     def adapter_list = adapter_fasta ? "--adapter_fasta ${adapter_fasta}" : ""
-    def fail_fastq = save_trimmed_fail && meta.single_end ? "--failed_out ${prefix}.fail.fastq.gz" : save_trimmed_fail && !meta.single_end ? "--unpaired1 ${prefix}_1.fail.fastq.gz --unpaired2 ${prefix}_2.fail.fastq.gz" : ''
+    def fail_fastq = save_trimmed_fail && meta.single_end ? "--failed_out ${prefix}.fail.fastq.gz" : save_trimmed_fail && !meta.single_end ? "--failed_out ${prefix}.paired.fail.fastq.gz --unpaired1 ${prefix}_1.fail.fastq.gz --unpaired2 ${prefix}_2.fail.fastq.gz" : ''
     // Added soft-links to original fastqs for consistent naming in MultiQC
     // Use single ended for interleaved. Add --interleaved_in in config.
     if ( task.ext.args?.contains('--interleaved_in') ) {
diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test
index 9b3f9a38..6f1f4897 100644
--- a/modules/nf-core/fastp/tests/main.nf.test
+++ b/modules/nf-core/fastp/tests/main.nf.test
@@ -251,7 +251,8 @@ nextflow_process {
     }
 
     test("fastp test_fastp_interleaved") {
-        config './nextflow.config'
+
+        config './nextflow.interleaved.config'
         when {
             params {
                 outdir   = "$outputDir"
@@ -277,7 +278,7 @@ nextflow_process {
             def html_text  = [ "Q20 bases:</td><td class='col2'>25.719000 K (93.033098%)",
 									"paired end (151 cycles + 151 cycles)"]
             def log_text   = [ "Q20 bases: 12922(92.9841%)",
-									"reads passed filter: 198"]
+									"reads passed filter: 162"]
             def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
 									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
 									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
@@ -321,7 +322,7 @@ nextflow_process {
 
         options '-stub'
 
-        config './nextflow.config'
+        config './nextflow.interleaved.config'
         when {
             params {
                 outdir   = "$outputDir"
@@ -427,6 +428,7 @@ nextflow_process {
 
     test("test_fastp_paired_end_trim_fail") {
 
+        config './nextflow.save_failed.config'
         when {
             params {
                 outdir   = "$outputDir"
@@ -454,7 +456,7 @@ nextflow_process {
 									"The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
             def log_text            = [ "No adapter detected for read1",
 									"Q30 bases: 12281(88.3716%)"]
-            def json_text           = ['"passed_filter_reads": 198']
+            def json_text           = ['"passed_filter_reads": 162']
             def read1_lines         = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
 									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
 									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
@@ -467,9 +469,9 @@ nextflow_process {
 									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/2",
 									"GCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT",
 									"AAAAA6EEAEEEEEAEEAEEAEEEEEEA6EEEEAEEAEEEEE6EEEEEEAEEEEA///A<<EEEEEEEEEAEEEEEE"]
-            def failed_read2_lines  = ["@ERR5069949.885966 NS500628:121:HK3MMAFX2:4:11610:19682:20132/2",
-									"CTTAGGTCTTAGGATTGGCTGTATCAACCTTAAGCTTAAGTACACAATTTTGCATAGAATGTCCAATAA",
-									"A//AA6EEAEEEEE6EEE/EEA/EA///AAE/EAEEEAE6AE/E/E/EEAAE/EAA/E/E/<EA//E/6"]
+            def failed_read2_lines  = ["@ERR5069949.973930 NS500628:121:HK3MMAFX2:2:21105:5548:5659/2",
+									"CCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAG",
+									"AAAAAEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEAE<EAEEEEEEAEEAEE"]
             // def failed_read1_lines = path(process.out.reads_fail.get(0).get(1).get(0)).linesGzip is empty file
             assertAll(
                 { assert process.success },
@@ -483,7 +485,7 @@ nextflow_process {
                     }
                 },
                 { failed_read2_lines.each { failed_read2_line ->
-                    { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) }
+                    { assert path(process.out.reads_fail.get(0).get(1).get(2)).linesGzip.contains(failed_read2_line) }
                     }
                 },
                 { html_text.each { html_part ->
diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap
index b4c0e1dd..3e876288 100644
--- a/modules/nf-core/fastp/tests/main.nf.test.snap
+++ b/modules/nf-core/fastp/tests/main.nf.test.snap
@@ -7,7 +7,7 @@
                         "id": "test",
                         "single_end": true
                     },
-                    "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4"
+                    "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22"
                 ]
             ]
         ],
@@ -15,7 +15,7 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-17T18:08:06.123035"
+        "timestamp": "2024-03-18T16:19:15.063001"
     },
     "test_fastp_paired_end_merged-for_stub_match": {
         "content": [
@@ -65,7 +65,7 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-17T18:06:00.223817"
+        "timestamp": "2024-03-18T16:18:43.526412"
     },
     "versions_paired_end": {
         "content": [
@@ -112,7 +112,7 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-02-01T12:03:37.827323085"
+        "timestamp": "2024-03-18T16:19:15.111894"
     },
     "test_fastp_paired_end_merged_match": {
         "content": [
@@ -283,7 +283,7 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-02-01T11:57:30.791982648"
+        "timestamp": "2024-03-18T16:18:43.580336"
     },
     "versions_paired_end_merged_adapterlist": {
         "content": [
diff --git a/modules/nf-core/fastp/tests/nextflow.interleaved.config b/modules/nf-core/fastp/tests/nextflow.interleaved.config
new file mode 100644
index 00000000..4be8dbd2
--- /dev/null
+++ b/modules/nf-core/fastp/tests/nextflow.interleaved.config
@@ -0,0 +1,5 @@
+process {
+    withName: FASTP {
+        ext.args = "--interleaved_in -e 30"
+    }
+}
diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.save_failed.config
similarity index 50%
rename from modules/nf-core/fastp/tests/nextflow.config
rename to modules/nf-core/fastp/tests/nextflow.save_failed.config
index 0f7849ad..53b61b0c 100644
--- a/modules/nf-core/fastp/tests/nextflow.config
+++ b/modules/nf-core/fastp/tests/nextflow.save_failed.config
@@ -1,6 +1,5 @@
 process {
-
     withName: FASTP {
-        ext.args = "--interleaved_in"
+        ext.args = "-e 30"
     }
 }
diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf
index 9e19a74c..d79f1c86 100644
--- a/modules/nf-core/fastqc/main.nf
+++ b/modules/nf-core/fastqc/main.nf
@@ -25,6 +25,11 @@ process FASTQC {
     def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[ reads, "${prefix}.${reads.extension}" ]] : reads.withIndex().collect { entry, index -> [ entry, "${prefix}_${index + 1}.${entry.extension}" ] }
     def rename_to = old_new_pairs*.join(' ').join(' ')
     def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ')
+
+    def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB')
+    // FastQC memory value allowed range (100 - 10000)
+    def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb)
+
     """
     printf "%s %s\\n" $rename_to | while read old_name new_name; do
         [ -f "\${new_name}" ] || ln -s \$old_name \$new_name
@@ -33,6 +38,7 @@ process FASTQC {
     fastqc \\
         $args \\
         --threads $task.cpus \\
+        --memory $fastqc_memory \\
         $renamed_files
 
     cat <<-END_VERSIONS > versions.yml
diff --git a/modules/nf-core/umicollapse/tests/main.nf.test b/modules/nf-core/umicollapse/tests/main.nf.test
index 36cd748b..2dec45b2 100644
--- a/modules/nf-core/umicollapse/tests/main.nf.test
+++ b/modules/nf-core/umicollapse/tests/main.nf.test
@@ -34,10 +34,7 @@ nextflow_process {
                 script "../../bwa/index/main.nf"
                 process{
                     """
-                    input[0] = [
-                            [ id:'sarscov2'],
-                            file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
-                            ]
+                    input[0] = [[ id:'sarscov2'],file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)]
                     """
                 }
             }
@@ -47,7 +44,8 @@ nextflow_process {
                     """
                     input[0] = UMITOOLS_EXTRACT.out.reads
                     input[1] = BWA_INDEX.out.index
-                    input[2] = true
+                    input[2] = [[ id:'sarscov2'],file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)]
+                    input[3] = true
                     """
                 }
             }
@@ -117,7 +115,8 @@ nextflow_process {
                     """
                     input[0] = UMITOOLS_EXTRACT.out.reads
                     input[1] = BWA_INDEX.out.index
-                    input[2] = true
+                    input[2] = [[ id:'sarscov2'],file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)]
+                    input[3] = true
                     """
                 }
             }
@@ -214,7 +213,8 @@ nextflow_process {
                     """
                     input[0] = UMITOOLS_EXTRACT.out.reads
                     input[1] = BWA_INDEX.out.index
-                    input[2] = true
+                    input[2] = [[ id:'sarscov2'],file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)]
+                    input[3] = true
                     """
                 }
             }
diff --git a/modules/nf-core/umicollapse/tests/main.nf.test.snap b/modules/nf-core/umicollapse/tests/main.nf.test.snap
index 23916f0b..861e9ca6 100644
--- a/modules/nf-core/umicollapse/tests/main.nf.test.snap
+++ b/modules/nf-core/umicollapse/tests/main.nf.test.snap
@@ -16,9 +16,9 @@
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "24.01.0"
+            "nextflow": "23.10.1"
         },
-        "timestamp": "2024-02-19T11:24:31.850566925"
+        "timestamp": "2024-03-14T13:41:23.869211282"
     },
     "umicollapse fastq tests": {
         "content": [
@@ -117,8 +117,8 @@
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "24.01.0"
+            "nextflow": "23.10.1"
         },
-        "timestamp": "2024-02-19T11:24:44.166029769"
+        "timestamp": "2024-03-14T13:41:54.486079388"
     }
 }
\ No newline at end of file
diff --git a/modules/nf-core/umitools/extract/tests/main.nf.test b/modules/nf-core/umitools/extract/tests/main.nf.test
index 83a77a1b..2a8eba15 100644
--- a/modules/nf-core/umitools/extract/tests/main.nf.test
+++ b/modules/nf-core/umitools/extract/tests/main.nf.test
@@ -12,9 +12,6 @@ nextflow_process {
     test("Should run without failures") {
 
         when {
-            params {
-                outdir = "$outputDir"
-            }
             process {
                 """
                 input[0] = [ [ id:'test', single_end:true ], // meta map
@@ -26,10 +23,9 @@ nextflow_process {
 
         then {
             assertAll (
-            { assert process.success },
-            { assert snapshot(process.out.versions).match("versions") }
+                { assert process.success },
+                { assert snapshot(process.out.versions).match("versions") }
             )
         }
-
     }
 }
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
index 8f1d82d3..961b5b4f 100644
--- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
@@ -3,6 +3,8 @@ nextflow_workflow {
     name "Test Workflow FASTQ_FASTQC_UMITOOLS_FASTP"
     script "../main.nf"
     workflow "FASTQ_FASTQC_UMITOOLS_FASTP"
+    config './nextflow.config'
+    
     tag "subworkflows"
     tag "subworkflows_nfcore"
     tag "subworkflows/fastq_fastqc_umitools_fastp"
@@ -29,8 +31,10 @@ nextflow_workflow {
 
                 input[0] = Channel.of([
                     [ id:'test', single_end:false ], // meta map
-                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
-                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
                 ])
                 input[1] = skip_fastqc
                 input[2] = with_umi
@@ -48,14 +52,503 @@ nextflow_workflow {
         then {
             assertAll(
                 { assert workflow.success },
-                { assert snapshot(workflow.out.reads).match("reads") },
-                { assert snapshot(workflow.out.umi_log).match("umi_log") },
-                { assert snapshot(workflow.out.trim_json).match("trim_json") },
-                { assert snapshot(workflow.out.trim_reads_fail).match("trim_reads_fail") },
-                { assert snapshot(workflow.out.trim_reads_merged).match("trim_reads_merged") },
-                { assert snapshot(workflow.out.adapter_seq).match("adapter_seq") },
-                { assert snapshot(workflow.out.trim_read_count).match("trim_read_count") },
-                { assert snapshot(workflow.out.versions).match("versions") },
+                { assert snapshot(
+                        workflow.out.reads,
+                        workflow.out.umi_log,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
+
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+
+    test("skip_fastqc") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = true
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end: false ], // meta map
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                        workflow.out.reads,
+                        workflow.out.umi_log,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
+
+                { assert !workflow.out.fastqc_raw_html },
+                { assert !workflow.out.fastqc_raw_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert !workflow.out.fastqc_trim_html },
+                { assert !workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+
+    test("with_umi") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
+
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+
+
+    test("skip_umi_extract") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = true
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                        workflow.out.reads,
+                        workflow.out.umi_log,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
+
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+
+    test("umi_discard_read = 2") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = true
+                umi_discard_read  = 2
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                        workflow.out.reads,
+                        workflow.out.umi_log,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
+
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+
+    test("skip_trimming") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = true
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                        workflow.out.reads.get(0).get(0), // Reads meta map
+                        // Because the input file is passed to the output file, we have to do check the filename only
+                        file(workflow.out.reads.get(0).get(1).get(0)).name,
+                        file(workflow.out.reads.get(0).get(1).get(1)).name,
+                        workflow.out.umi_log,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
+
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert !workflow.out.trim_html },
+                { assert !workflow.out.trim_log },
+                { assert !workflow.out.fastqc_trim_html },
+                { assert !workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+
+    test("save_trimmed_fail") {
+
+        config './nextflow.save_trimmed.config'
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = true
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                        workflow.out.reads,
+                        workflow.out.umi_log,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
+
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+
+    test("save_merged") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = true
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                        workflow.out.reads,
+                        workflow.out.umi_log,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
+
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+
+    test("min_trimmed_reads = 26") {
+        // Subworkflow should stop after FASTP which trims down to 25 reads
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = true
+                min_trimmed_reads = 26
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ 
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                        workflow.out.reads,
+                        workflow.out.umi_log,
+                        workflow.out.trim_json,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.adapter_seq,
+                        workflow.out.trim_read_count,
+                        workflow.out.versions
+                    ).match() 
+                },
 
                 { assert workflow.out.fastqc_raw_html },
                 { assert workflow.out.fastqc_raw_zip },
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
index 89ba8da1..3e11d9ec 100644
--- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
@@ -1,30 +1,186 @@
 {
-    "trim_reads_merged": {
+    "skip_fastqc": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ],
             [
                 
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-12T08:38:50.041635573"
+        "timestamp": "2024-03-18T16:53:49.315194"
     },
-    "trim_reads_fail": {
+    "save_trimmed_fail": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7",
+                        "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a"
+                    ]
+                ]
+            ],
             [
                 
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366",
+                        "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6",
+                        "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    162
+                ]
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-12T08:38:50.033284693"
+        "timestamp": "2024-03-18T16:51:45.34934"
     },
-    "versions": {
+    "skip_umi_extract": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ],
             [
                 "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
                 "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
@@ -35,10 +191,25 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-12T08:38:50.121510557"
+        "timestamp": "2024-03-18T12:07:40.34249"
     },
-    "trim_json": {
+    "umi_discard_read = 2": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
             [
                 [
                     {
@@ -47,16 +218,81 @@
                     },
                     "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
                 ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-12T08:38:50.024410724"
+        "timestamp": "2024-03-18T12:08:24.141938"
     },
-    "adapter_seq": {
+    "save_merged": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+                        "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+                ]
+            ],
             [
                 [
                     {
@@ -65,15 +301,65 @@
                     },
                     "unspecified"
                 ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    75
+                ]
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-12T08:38:50.08674429"
+        "timestamp": "2024-03-18T12:10:18.546963"
     },
-    "reads": {
+    "skip_trimming": {
+        "content": [
+            {
+                "id": "test",
+                "single_end": false
+            },
+            "test_1.fastq.gz",
+            "test_2.fastq.gz",
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "23.10.1"
+        },
+        "timestamp": "2024-03-19T15:49:26.574759"
+    },
+    "sarscov2 paired-end [fastq]": {
         "content": [
             [
                 [
@@ -86,42 +372,178 @@
                         "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
                     ]
                 ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-12T08:38:49.994419936"
+        "timestamp": "2024-03-18T16:53:39.139038"
     },
-    "umi_log": {
+    "min_trimmed_reads = 26": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+                        "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+                    ]
+                ]
+            ],
             [
                 
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    75
+                ]
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-12T08:38:50.017720214"
+        "timestamp": "2024-03-18T11:52:23.849945"
     },
-    "trim_read_count": {
+    "with_umi": {
         "content": [
             [
                 [
                     {
                         "id": "test",
-                        "single_end": false
+                        "single_end": true
                     },
-                    198
+                    "test.fastp.fastq.gz:md5,ba8c6c3a7ce718d9a2c5857e2edf53bc"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.json:md5,d39c5c6d9a2e35fb60d26ced46569af6"
                 ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    ""
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    99
+                ]
+            ],
+            [
+                "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721",
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-01-12T08:38:50.102326089"
+        "timestamp": "2024-03-18T17:31:09.193212"
     }
 }
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.config b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.config
new file mode 100644
index 00000000..12f7b257
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.config
@@ -0,0 +1,11 @@
+process {
+
+    withName: UMITOOLS_EXTRACT {
+        ext.args = '--bc-pattern="NNNN" --bc-pattern2="NNNN"'
+    }
+
+    withName: UMICOLLAPSE {
+        ext.prefix = { "${meta.id}.dedup" }
+    }
+    
+}
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.save_trimmed.config b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.save_trimmed.config
new file mode 100644
index 00000000..2430e9d5
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.save_trimmed.config
@@ -0,0 +1,6 @@
+process {
+    // Make filtering more aggressive to make more reads fail
+    withName: FASTP {
+        ext.args = "-e 30"
+    }
+}
\ No newline at end of file