diff --git a/docs/coding-challenges/exercism/nucleotide-count.md b/docs/coding-challenges/exercism/nucleotide-count.md
new file mode 100644
index 000000000..5988dd6d4
--- /dev/null
+++ b/docs/coding-challenges/exercism/nucleotide-count.md
@@ -0,0 +1,373 @@
+# Nucleotide Count
+
+![RNA Transcription](https://github.com/practicalli/graphic-design/blob/live/code-challenges/exercism/rna-transcription.png?raw=true)
+
+[:globe_with_meridians: Clojure Track: Nucleotide Count](https://exercism.org/tracks/clojure/exercises/nucleotide-count){target=_blank .md-button}
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+
+If the string contains characters other than A, C, G, or T then an error should be throw.
+
+Represent a DNA sequence as an ordered collection of nucleotides, e.g. a string of characters such as "ATTACG".
+
+
+```shell
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
+
+!!! INFO "DNA Nucleotide names"
+    `A` is Adenine, `C` is Cytosine, `G` is Guanine and `T` is Thymine
+
+
+!!! HINT "Code for this solution on GitHub"
+    [practicalli/exercism-clojure-guides](https://github.com/practicalli/exercism-clojure-guides/) contains the design journal and solution to this exercise and many others.
+
+
+## Create the project
+
+Download the Nucleotide Count exercise using the exercism CLI tool
+
+!!! NOTE ""
+    ```bash
+    exercism download --exercise=nucleotide-count --track=clojure
+    ```
+
+!!! HINT "Use the REPL workflow to explore solutions locally"
+    Open the project in a [Clojure aware editor](/clojure/clojure-editors) and [start a REPL](/clojure/coding-challenges/exercism/#repl-workflow), using a rich comment form to experiment with code to solve the challenge.
+
+
+## Starting point
+
+Unit test code calls functions from the `src` tree which must exist with the correct argument signature for the unit test code to compile successfully.
+
+Reviewing each assertion in the unit test code identifies the function definitions required.
+
+??? EXAMPLE "Exercism Unit Tests"
+    ```clojure
+    (ns nucleotide-count-test
+      (:require [clojure.test :refer [deftest is]]
+                nucleotide-count))
+
+    (deftest empty-dna-strand-has-no-adenosine
+      (is (= 0 (nucleotide-count/count-of-nucleotide-in-strand \A, ""))))
+
+    (deftest empty-dna-strand-has-no-nucleotides
+      (is (= {\A 0, \T 0, \C 0, \G 0}
+             (nucleotide-count/nucleotide-counts ""))))
+
+    (deftest repetitive-cytidine-gets-counted
+      (is (= 5 (nucleotide-count/count-of-nucleotide-in-strand \C "CCCCC"))))
+
+    (deftest repetitive-sequence-has-only-guanosine
+      (is (= {\A 0, \T 0, \C 0, \G 8}
+             (nucleotide-count/nucleotide-counts "GGGGGGGG"))))
+
+    (deftest counts-only-thymidine
+      (is (= 1 (nucleotide-count/count-of-nucleotide-in-strand \T "GGGGGTAACCCGG"))))
+
+    (deftest validates-nucleotides
+      (is (thrown? Throwable (nucleotide-count/count-of-nucleotide-in-strand \X "GACT"))))
+
+    (deftest counts-all-nucleotides
+      (let [s "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"]
+        (is (= {\A 20, \T 21, \G 17, \C 12}
+               (nucleotide-count/nucleotide-counts s)))))
+    ```
+
+
+!!! EXAMPLE "Function definitions required to compile unit test code"
+    ```clojure title="src/nucleotide_count.clj"
+    (ns nucleotide-count)
+
+    (defn count-of-nucleotide-in-strand
+      "Count how many of a given nucleotide is in a strand"
+      [nucleotide strand])
+
+    (defn nucleotide-counts
+      "Count all nucleotide in a strand"
+      [strand])
+    ```
+
+
+## Making the tests pass
+
+Select one assertion from the unit tests and write code to make the test pass.
+
+Experiment with solutions in the `comment` form and add the chosen approach to the respective function definition.
+
+
+## Counting nucleotides
+
+Use test data from the unit test code, e.g. `"GGGGGTAACCCGG"`
+
+How often does a nucleotide appear
+
+!!! EXAMPLE
+    ```clojure
+      (map
+        #(if (= % \A) 1 0)
+        "GGGGGTAACCCGG")
+    ```
+
+
+Add the result to get the total count
+
+!!! EXAMPLE
+    ```clojure
+      (count
+       (map
+         #(if (= % \A) 1 0)
+         "GGGGGTAACCCGG"))
+    ```
+
+Is there a more elegant way?
+
+When only the matching nucleotide is in the strand, then all the elements of the strand can be counted.
+
+`filter` the DNA strand with a predicate function (returns true/false) that returns only the matching nucleotide.
+
+!!! EXAMPLE
+    ```clojure
+      (filter #(= % \A) valid-nucleotides))
+    ```
+
+  ;; Count the elements in the returned sequence for the total
+
+
+!!! EXAMPLE
+    ```clojure
+      (count
+       (filter #(= % \A) valid-nucleotides))
+    ```
+
+
+Add this code into the starting function
+
+
+### Run unit tests
+
+Run the unit tests to see if they pass.  x should pass, x should fail.
+
+
+### Nucleotide occurances
+
+Count the occurances
+
+   "GGGGGTAACCCGG"
+
+
+```clojure
+   (count
+     (filter (fn [nucleotide] (= nucleotide \A))
+             "GGGGGTAACCCGG"))
+```
+
+
+Define the data
+
+```clojure
+  (def valid-nucleotides
+    "Characters representing valid nucleotides"
+    [\A \C \G \T])
+```
+
+Exception handling required
+
+```clojure
+(throw (Throwable.)) if nucleotide is \X
+```
+
+Or use a predicate with some (some element? in the sequence)
+
+```clojure
+  (some #(= \G %) valid-nucleotides)
+
+  (some #{\G} valid-nucleotides)
+```
+
+```clojure
+  (defn count-of-nucleotide-in-strand
+    [nucleotide strand]
+    (if (some #(= nucleotide %) valid-nucleotides)
+      (count
+       (filter #(= nucleotide %)
+               strand))
+      (throw (Throwable.))))
+
+  (count-of-nucleotide-in-strand \T "GGGGGTAACCCGG")
+```
+
+
+Design the second function
+
+How often does a nucleotide appear
+
+```clojure
+  (map
+    #(if (= % \A) 1 0)
+    valid-nucleotides)
+```
+
+Add the result to get the total count
+
+Is there a more elegant way?
+
+```clojure
+  (filter #(= % \A) valid-nucleotides)
+```
+
+Count the elements in the returned sequence for the total
+
+Design the second function
+
+How often does a nucleotide appear
+
+NOTE: zero must be returned when there are no appearences
+
+Return value always in the form
+
+```clojure
+  {\A 20, \T 21, \G 17, \C 12}
+```
+
+### Hammock time...
+
+- How often does something appear,
+- how frequenct is it?
+- Is there a clojure standard library for that (approx 700 functions), review <https://clojure-docs.org/>
+
+
+```clojure
+  (frequencies "GGGGGAACCCGG")
+```
+
+If there are missing nucleotides then there is no answer
+
+What if there is a starting point
+
+```clojure
+  {\A 0 \C 0 \G 0 \T 0}
+```
+
+  ;; Then merge the result of frequencies
+
+```clojure
+  (merge {\A 0 \C 0 \G 0 \T 0}
+         (frequencies "GGGGGAACCCGG"))
+```
+
+Update the function definition and run tests
+
+
+## Solutions
+
+There are many ways to solve a challenge and there is value trying different approaches to help learn more about the Clojure language.
+
+The following solution includes `filter` and `frequencies` functions which are commonly used functions from the Clojure standard library.
+
+!!! EXAMPLE "Example Solution"
+    ```clojure title="src/nucleotide_count.clj"
+    (ns nucleotide-count)
+
+    (def valid-nucleotides
+        "Characters representing valid nucleotides"
+        [\A \C \G \T])
+
+    (defn count-of-nucleotide-in-strand
+      [nucleotide strand]
+      (if (some #(= nucleotide %) valid-nucleotides)
+        (count
+         (filter #(= nucleotide %)
+                 strand))
+        (throw (Throwable.))))
+
+    (defn nucleotide-counts
+      "Count all nucleotide in a strand"
+      [strand]
+      (merge {\A 0 \C 0 \G 0 \T 0}
+             (frequencies "GGGGGAACCCGG")))
+    ```
+
+
+
+
+
+
+<!--
+
+;; ---------------------------------------------------------
+;; Solution
+
+
+  #_(defn count-of-nucleotide-in-strand [nucleotide strand]
+      (if (= \X nucleotide)
+        (throw (Throwable.))
+        (count (filter #(= nucleotide %) strand))))
+
+  #_(defn nucleotide-counts [strand]
+      (apply merge
+             (for [nucleotide strand]
+               {nucleotide
+                (count-of-nucleotide-in-strand nucleotide strand)})))
+
+
+
+
+  #_(defn count-of-nucleotide-in-strand [nucleotide strand]
+      (if (some (set nucleotide) valid-nucleotides)
+       (count (filter #(= nucleotide %) strand))
+       (throw (Throwable.)))))
+
+
+;; End of Solution
+;; ---------------------------------------------------------
+
+
+(comment)
+
+
+#_{:clj-kondo/ignore [:redefined-var]}
+
+#_() ; End of rich comment
+
+
+  ;; (defn count-of-nucleotide-in-strand [nucleotide strand]
+  ;;   (get (frequencies strand) nucleotide (throw (Throwable.))))
+
+;; add a guard condition if passed an empty strand
+;; returning zero
+
+  ;; (defn count-of-nucleotide-in-strand [nucleotide strand]
+  ;;   (if (empty? strand)
+  ;;     0
+  ;;     (get (frequencies strand) nucleotide (throw (Throwable.)))))
+
+  ;; (count-of-nucleotide-in-strand \T "GGGGGTAACCCGG")
+
+;; using a function as the not-found
+  ;; (get {:a 1 :b 2} :b (throw (Throwable.)))
+
+
+;; unfortunately the throw expression is evaluated before the get
+;; so we always get a Throwable exception even if the key is in the hash-map.
+;; We can fix that with an or
+
+  ;; (defn count-of-nucleotide-in-strand [nucleotide strand]
+  ;;   (if (empty? strand)
+  ;;     0
+  ;;     (or (get (frequencies strand) nucleotide)
+  ;;         (throw (Throwable.)))))
+  ;;
+  ;; (defn nucleotide-counts [strand]
+  ;;   (frequencies strand))
+  ;;
+;; fails the empty case,
+;; but we can add an empty result as the default value
+;; and merge it with the resulting frequencies
+
+
+  ;; (defn nucleotide-counts [strand]
+  ;;   (merge {\A 0 \C 0 \G 0 \T 0} (frequencies strand)))
+
+-->
diff --git a/mkdocs.yml b/mkdocs.yml
index 43b2ec1b7..c9861825b 100644
--- a/mkdocs.yml
+++ b/mkdocs.yml
@@ -198,6 +198,7 @@ nav:
           # - coding-challenges/exercism/hamming.md
           # - coding-challenges/exercism/space-age.md
           - RNA Transcription: coding-challenges/exercism/rna-transcription.md
+          - Nucleotide Count: coding-challenges/exercism/nucleotide-count.md
           - Bob:
               - coding-challenges/exercism/bob/index.md
               - coding-challenges/exercism/bob/bob-string-approach.md