-
Notifications
You must be signed in to change notification settings - Fork 13
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
NxTrim-0.4.0 Segmentation fault (core dumped) #17
Comments
Are there any other good tools that can remove adapter of mate pair lib? The result of trimmomatic 0.35(simple mode) seems Not Good |
a dirty fix. diff --git a/fastqlib.cpp b/fastqlib.cpp remove add |
Thanks for the bug report. I just pushed a fix (very similar to your own). The bug was introduced in v0.4.0 when I swapped to kseq for file i/o. |
The bug is fixed and please close the issue. And the result of NxTrim is much better than trimmomatic (simple mode) when mate lib fastq file. |
[root@T630 NxTrim-0.4.0]# ./nxtrim -1 /arch/fastq/juglans.DNA/Mate/SRR2057824_1.fastq.gz -2 /arch/fastq/juglans.DNA/Mate/SRR2057824_2.fastq.gz -O mate
Output: mate.*.fastq.gz
Trimming:
R1: /arch/fastq/juglans.DNA/Mate/SRR2057824_1.fastq.gz
R2: /arch/fastq/juglans.DNA/Mate/SRR2057824_2.fastq.gz
Segmentation fault (core dumped)
[root@T630 NxTrim-0.4.0]# gdb ./nxtrim ./core.76735
(gdb) where
#0 0x00007fb25dd99961 in __strlen_sse2_pminub () from /lib64/libc.so.6
#1 0x00000000004082cd in fastqReader::next(fqread&) ()
#2 0x0000000000408b04 in pairReader::next(readPair&) ()
#3 0x000000000040264d in main ()
(gdb) q
[root@T630 NxTrim-0.4.0]# zless /arch/fastq/juglans.DNA/Mate/SRR2057824_1.fastq.gz
[root@T630 NxTrim-0.4.0]# zless /arch/fastq/juglans.DNA/Mate/SRR2057824_1.fastq.gz|head
@DJB77P1:542:H881JADXX:1:1101:1162:2100
NTTTATTTTTTTTCTTTTTCCTCTCGGTTTCTCTCTGTCTCTCACCGTGTGCTTCTCTCGATCATCTCTCTCTCCCTCTCTATCATTTTTTCAACTGCCCAGGCACCTGTCTCTNATACACATCTAGATGTGTATAAGAGACAGGAGTGTG
+DJB77P1:542:H881JADXX:1:1101:1162:2100
#1=BDFDDHDFDHIIIIGHGFEE>FGDBDGH@F9B?DDFGIEGHHGGG;=CCDH>CHEHE?CDBCECCAECCCCCCCC9?C>CCCDDD@CBC@@>@ACAB488ABBA3+:@cc#+88?C@CCC:CAD:BCDDDC>@cc?<B?<9?>:
@DJB77P1:542:H881JADXX:1:1101:1155:2123
TGCGCGAGAAAACTATTGAGTAAAAGGCAAGAAAGTGTGAGACAATTATCTGGAAACTGTCTCTTATACACATCTAGATGTGTATAAGAGACAGGTTCTTGGNTAAATTTATGTNTTGGTTGATGTTTACCCATGTGATCTTGAGTTTGAA
+DJB77P1:542:H881JADXX:1:1101:1155:2123
?@@da@@@FFDHHDEHIHIFCFHI<CFGH@GIEGC9?09?FAGGHIIIIGG8;C=@FGGA=CEAEHEEAA>;;@cc3;3..>BCC@@;9=(58,55::@@#+8?B@@3>@::#+++(+289::4>>>AAC@CC(:(::4>C>C######
@DJB77P1:542:H881JADXX:1:1101:1180:2131
CATTAATTATTGCATACTGCTAGTATATCTAGAAGCATTGCATATTATTTGTCATGTACGAGGAGTATGTAGCCCTGTGTTGCATGTCCCGTCGTTTCAGTCACAATCCAATCCCAAGCGGGGGCTGGGAGCGCCACACAATGTATAGATT
[root@T630 NxTrim-0.4.0]#
The text was updated successfully, but these errors were encountered: