From ab826041528a92a6e8b326bb4b4432cc00629505 Mon Sep 17 00:00:00 2001
From: tdayris <tdayris@gustaveroussy.fr>
Date: Mon, 21 Sep 2020 09:16:53 +0200
Subject: [PATCH 01/34] [fix] (template): Missing code in wrappers' doc. Error
 #187

---
 docs/generate_docs.py | 12 ++++++------
 1 file changed, 6 insertions(+), 6 deletions(-)

diff --git a/docs/generate_docs.py b/docs/generate_docs.py
index c471d06d2f..446fe83a9e 100644
--- a/docs/generate_docs.py
+++ b/docs/generate_docs.py
@@ -34,10 +34,10 @@
     TOOL_TEMPLATE = Template(f.read())
 
 with open(os.path.join(BASE_DIR, "_templates", "wrapper.rst")) as f:
-    TEMPLATE = Template(f.read())
+    TEMPLATE_WRAPPER = Template(f.read())
 
 with open(os.path.join(BASE_DIR, "_templates", "meta_wrapper.rst")) as f:
-    TEMPLATE = Template(f.read())
+    TEMPLATE_META = Template(f.read())
 
 
 def get_tool_dir(tool):
@@ -88,7 +88,7 @@ def render_wrapper(path, target):
     name = meta["name"].replace(" ", "_") + ".rst"
     os.makedirs(os.path.dirname(target), exist_ok=True)
     with open(target, "w") as readme:
-        rst = TEMPLATE.render(
+        rst = TEMPLATE_WRAPPER.render(
             snakefile=snakefile,
             wrapper=wrapper,
             wrapper_lang=wrapper_lang,
@@ -113,7 +113,7 @@ def render_meta(path, target):
 
     with open(os.path.join(path, "test", "Snakefile")) as snakefile:
         snakefile = textwrap.indent(snakefile.read(), "    ").replace("master", TAG)
-        
+
     wrappers = []
     for uw in used_wrappers:
         wrapper = os.path.join(WRAPPER_DIR, uw, "wrapper.py")
@@ -124,11 +124,11 @@ def render_meta(path, target):
         with open(wrapper) as wrapper:
             wrapper = textwrap.indent(wrapper.read(), "    ")
             wrappers.append((wrapper, wrapper_lang, uw))
-            
+
     name = meta["name"].replace(" ", "_") + ".rst"
     os.makedirs(os.path.dirname(target), exist_ok=True)
     with open(target, "w") as readme:
-        rst = TEMPLATE.render(
+        rst = TEMPLATE_META.render(
             snakefile=snakefile,
             wrappers=wrappers,
             usedwrappers=used_wrappers,

From ac4ac819fee80f7ed27b6b801aed37b76f0a84ef Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Johannes=20K=C3=B6ster?= <johannes.koester@uni-due.de>
Date: Tue, 11 Oct 2022 17:48:16 +0200
Subject: [PATCH 02/34] perf: update utils/datavzrd/environment.yaml. (#566)

---
 utils/datavzrd/environment.yaml | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/utils/datavzrd/environment.yaml b/utils/datavzrd/environment.yaml
index 0c9a143105..ca8153a60b 100644
--- a/utils/datavzrd/environment.yaml
+++ b/utils/datavzrd/environment.yaml
@@ -1,5 +1,5 @@
 channels:
-  - conda-forge
-  - nodefaults
+- conda-forge
+- nodefaults
 dependencies:
-  - datavzrd =2.0
+- datavzrd =2.3.2

From 88c479c7a645478129de28bd8ce9842cc63bc549 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Johannes=20K=C3=B6ster?= <johannes.koester@uni-due.de>
Date: Tue, 11 Oct 2022 17:48:58 +0200
Subject: [PATCH 03/34] perf: update bio/bcftools/call/environment.yaml. (#567)

---
 bio/bcftools/call/environment.yaml | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/bio/bcftools/call/environment.yaml b/bio/bcftools/call/environment.yaml
index 538f1a87f1..d89e6b9cad 100644
--- a/bio/bcftools/call/environment.yaml
+++ b/bio/bcftools/call/environment.yaml
@@ -3,5 +3,5 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - bcftools =1.14
-  - snakemake-wrapper-utils =0.4
+  - bcftools =1.16
+  - snakemake-wrapper-utils =0.5.0

From 8d92bb553869d722a7d1e9dda25c725b74de3450 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Johannes=20K=C3=B6ster?= <johannes.koester@uni-due.de>
Date: Tue, 11 Oct 2022 17:49:11 +0200
Subject: [PATCH 04/34] perf: update bio/bcftools/concat/environment.yaml.
 (#568)

---
 bio/bcftools/concat/environment.yaml | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/bio/bcftools/concat/environment.yaml b/bio/bcftools/concat/environment.yaml
index 538f1a87f1..d89e6b9cad 100644
--- a/bio/bcftools/concat/environment.yaml
+++ b/bio/bcftools/concat/environment.yaml
@@ -3,5 +3,5 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - bcftools =1.14
-  - snakemake-wrapper-utils =0.4
+  - bcftools =1.16
+  - snakemake-wrapper-utils =0.5.0

From 1c444dc57592877fed4307de7bbde466d4bc8aeb Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Johannes=20K=C3=B6ster?= <johannes.koester@uni-due.de>
Date: Tue, 11 Oct 2022 18:53:13 +0200
Subject: [PATCH 05/34] perf: autobump bio/bcftools/index/environment.yaml
 (#570)

* perf: update bio/bcftools/index/environment.yaml.

* perf: update bio/bcftools/index/environment.yaml.

* perf: update bio/bcftools/index/environment.yaml.
---
 bio/bcftools/index/environment.yaml | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/bio/bcftools/index/environment.yaml b/bio/bcftools/index/environment.yaml
index 538f1a87f1..d89e6b9cad 100644
--- a/bio/bcftools/index/environment.yaml
+++ b/bio/bcftools/index/environment.yaml
@@ -3,5 +3,5 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - bcftools =1.14
-  - snakemake-wrapper-utils =0.4
+  - bcftools =1.16
+  - snakemake-wrapper-utils =0.5.0

From 534f834b4267f3d6064625dca8efaa604daaac25 Mon Sep 17 00:00:00 2001
From: "github-actions[bot]"
 <41898282+github-actions[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 09:54:24 +0200
Subject: [PATCH 06/34] chore: release 1.15.1 (#569)

Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com>
---
 CHANGELOG.md | 10 ++++++++++
 1 file changed, 10 insertions(+)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 3ee4a46003..7e630327cc 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -1,5 +1,15 @@
 # Changelog
 
+### [1.15.1](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.0...v1.15.1) (2022-10-11)
+
+
+### Performance Improvements
+
+* autobump bio/bcftools/index/environment.yaml ([#570](https://www.github.com/snakemake/snakemake-wrappers/issues/570)) ([bc77e03](https://www.github.com/snakemake/snakemake-wrappers/commit/bc77e037a0a086c1fede8cd54481426001460a13))
+* update bio/bcftools/call/environment.yaml. ([#567](https://www.github.com/snakemake/snakemake-wrappers/issues/567)) ([5c4356a](https://www.github.com/snakemake/snakemake-wrappers/commit/5c4356af4a2bcb288f4fe71169f97151df524d52))
+* update bio/bcftools/concat/environment.yaml. ([#568](https://www.github.com/snakemake/snakemake-wrappers/issues/568)) ([70685f1](https://www.github.com/snakemake/snakemake-wrappers/commit/70685f12db06ffe17f09aff7ecd258bcff27284a))
+* update utils/datavzrd/environment.yaml. ([#566](https://www.github.com/snakemake/snakemake-wrappers/issues/566)) ([a6f4ff8](https://www.github.com/snakemake/snakemake-wrappers/commit/a6f4ff88e1cf9949737de779b0cc8a56d749e374))
+
 ## [1.15.0](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.14.1...v1.15.0) (2022-10-11)
 
 

From 7eb277c0f2cfeda2910deddd2d23ccc9791c3e0a Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 17:08:37 +0200
Subject: [PATCH 07/34] perf: update bio/bgzip/environment.yaml. (#577)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/bgzip/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/bgzip/environment.yaml b/bio/bgzip/environment.yaml
index 7eed2f5823..54ca0cec72 100644
--- a/bio/bgzip/environment.yaml
+++ b/bio/bgzip/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - htslib ==1.12
+  - htslib =1.16

From 63f8acbba81f926b63a36d6496ee668e60ed5099 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 17:09:03 +0200
Subject: [PATCH 08/34] perf: update bio/bellerophon/environment.yaml. (#576)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/bellerophon/environment.yaml | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/bio/bellerophon/environment.yaml b/bio/bellerophon/environment.yaml
index 183b281d82..039e9257a3 100644
--- a/bio/bellerophon/environment.yaml
+++ b/bio/bellerophon/environment.yaml
@@ -4,5 +4,5 @@ channels:
   - nodefaults
 dependencies:
   - bellerophon =1.0
-  - samtools =1.15
-  - snakemake-wrapper-utils =0.4
+  - samtools =1.16.1
+  - snakemake-wrapper-utils =0.5.0

From 963bedf2fe0c66fa3241aaf079318d4aa005d5bd Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 17:16:50 +0200
Subject: [PATCH 09/34] perf: update bio/assembly-stats/environment.yaml.
 (#575)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/assembly-stats/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/assembly-stats/environment.yaml b/bio/assembly-stats/environment.yaml
index b66f099064..6fc2437545 100644
--- a/bio/assembly-stats/environment.yaml
+++ b/bio/assembly-stats/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - assembly-stats=1.0
+  - assembly-stats =1.0.1

From ff74710cd1b7c9299a75cae5e53caf29f7da45dc Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 17:17:15 +0200
Subject: [PATCH 10/34] perf: update bio/adapterremoval/environment.yaml.
 (#573)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/adapterremoval/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/adapterremoval/environment.yaml b/bio/adapterremoval/environment.yaml
index 103f6d80c8..90c6cc7618 100644
--- a/bio/adapterremoval/environment.yaml
+++ b/bio/adapterremoval/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - adapterremoval =2.3
+  - adapterremoval =2.3.3

From bb60c16a434ef1e5ee10e16dfb00f698fcae1933 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Johannes=20K=C3=B6ster?= <johannes.koester@uni-due.de>
Date: Wed, 12 Oct 2022 22:43:01 +0200
Subject: [PATCH 11/34] chore: autobump conda envs (#571)

* Add autobump action

* fix paths

* dbg

* dbg branch

* add checkout

* dbg

* trigger rerun

* entity regex and add label

* dbg

* Update autobump.yml

* Update autobump.yml
---
 .github/workflows/autobump.yml | 26 ++++++++++++++++++++++++++
 .github/workflows/main.yml     | 17 ++++++++---------
 2 files changed, 34 insertions(+), 9 deletions(-)
 create mode 100644 .github/workflows/autobump.yml

diff --git a/.github/workflows/autobump.yml b/.github/workflows/autobump.yml
new file mode 100644
index 0000000000..c283cc31ba
--- /dev/null
+++ b/.github/workflows/autobump.yml
@@ -0,0 +1,26 @@
+name: Tests
+
+# TODO replace by nightly cron job
+on:
+  schedule:
+    - cron: "0 0 * * 5"
+
+jobs:
+  autobump:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: actions/checkout@v3
+
+      - uses: tibdex/github-app-token@v1
+        id: generate-token
+        with:
+          app_id: ${{ secrets.SNAKEDEPLOY_BOT_APP_ID }}
+          private_key: ${{ secrets.SNAKEDEPLOY_BOT_PRIVATE_KEY }}
+
+      - name: Update conda envs
+        uses: snakemake/snakedeploy-github-action@v1
+        env:
+          GITHUB_TOKEN: ${{ steps.generate-token.outputs.token }}
+        with:
+          subcommand: update-conda-envs
+          args: "*/*/environment.yaml */*/*/environment.yaml --create-prs --entity-regex '(?P<entity>.+)/environment.yaml' --pr-add-label"
diff --git a/.github/workflows/main.yml b/.github/workflows/main.yml
index d98c071f64..9bf2756a55 100644
--- a/.github/workflows/main.yml
+++ b/.github/workflows/main.yml
@@ -5,9 +5,8 @@ on:
     branches:
       - master
   pull_request:
-    branches_ignore: []
-  schedule:
-    - cron: '0 0 * * 0'
+    branches:
+      - "*"
 
 jobs:
   docs:
@@ -37,12 +36,12 @@ jobs:
 
       - name: Setup Snakemake environment
         run: |
-           # ensure that mamba is happy to write into the cache
-           sudo chown -R runner:docker /usr/share/miniconda/pkgs/cache
-           conda install -c conda-forge mamba --quiet
-           export PATH="/usr/share/miniconda/bin:$PATH"
-           mamba create -c bioconda -c conda-forge --quiet -y --name snakemake snakemake-minimal pytest
-           conda config --set channel_priority strict
+          # ensure that mamba is happy to write into the cache
+          sudo chown -R runner:docker /usr/share/miniconda/pkgs/cache
+          conda install -c conda-forge mamba --quiet
+          export PATH="/usr/share/miniconda/bin:$PATH"
+          mamba create -c bioconda -c conda-forge --quiet -y --name snakemake snakemake-minimal pytest
+          conda config --set channel_priority strict
 
       - name: Fetch master
         if: github.ref != 'refs/heads/master'

From d9a7a6a07ab3ddd05bddd6eacfbbaf8df508f545 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:43:40 +0200
Subject: [PATCH 12/34] perf: update bio/delly/environment.yaml. (#584)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/delly/environment.yaml | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/bio/delly/environment.yaml b/bio/delly/environment.yaml
index 317555d323..36236c9c4e 100644
--- a/bio/delly/environment.yaml
+++ b/bio/delly/environment.yaml
@@ -3,6 +3,6 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - delly =1.1
-  - bcftools =1.15
-  - snakemake-wrapper-utils =0.5
+  - delly =1.1.5
+  - bcftools =1.16
+  - snakemake-wrapper-utils =0.5.0

From e0220d24499a1ebf1171275f99b128ee5afe8273 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:44:10 +0200
Subject: [PATCH 13/34] perf: update bio/busco/environment.yaml. (#581)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/busco/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/busco/environment.yaml b/bio/busco/environment.yaml
index cfe994795f..87ce734f22 100644
--- a/bio/busco/environment.yaml
+++ b/bio/busco/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - busco =5.4
+  - busco =5.4.3

From ae10993c0e9fe2d54b9fedb40d0cacd0aef0e0cd Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:44:32 +0200
Subject: [PATCH 14/34] perf: update bio/clustalo/environment.yaml. (#582)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/clustalo/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/clustalo/environment.yaml b/bio/clustalo/environment.yaml
index a175ee2561..fb35b22979 100644
--- a/bio/clustalo/environment.yaml
+++ b/bio/clustalo/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - clustalo ==1.2.4
+  - clustalo =1.2.4

From 76c984548ecec43767c5a7f87dd1ecd9800ff981 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:47:32 +0200
Subject: [PATCH 15/34] perf: update bio/fastp/environment.yaml. (#585)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/fastp/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/fastp/environment.yaml b/bio/fastp/environment.yaml
index 6917a8a91b..ac25faab42 100644
--- a/bio/fastp/environment.yaml
+++ b/bio/fastp/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - fastp =0.20
+  - fastp =0.23.2

From 853a36dc2bd1ef297d3289785d21d6f1c4399354 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:48:04 +0200
Subject: [PATCH 16/34] perf: update bio/fastq_screen/environment.yaml. (#586)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/fastq_screen/environment.yaml | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/bio/fastq_screen/environment.yaml b/bio/fastq_screen/environment.yaml
index cd5d5b081f..c718b52e1e 100644
--- a/bio/fastq_screen/environment.yaml
+++ b/bio/fastq_screen/environment.yaml
@@ -3,6 +3,6 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - fastq-screen ==0.5.2
-  - bowtie2 ==2.2.6
-  - bowtie ==1.1.2
+  - fastq-screen =0.15.2
+  - bowtie2 =2.4.5
+  - bowtie =1.3.1

From 576c54a8776d3007222d5f2a98c8be60a7faa195 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:48:28 +0200
Subject: [PATCH 17/34] perf: update bio/fasttree/environment.yaml. (#588)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/fasttree/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/fasttree/environment.yaml b/bio/fasttree/environment.yaml
index 3df4697cf2..4ce2c61178 100644
--- a/bio/fasttree/environment.yaml
+++ b/bio/fasttree/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - fasttree ==2.1.10
+  - fasttree =2.1.11

From e473ff76012e3e67aff2ae6b4a4e841bf7a97e2b Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:48:47 +0200
Subject: [PATCH 18/34] perf: update bio/fastqc/environment.yaml. (#587)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/fastqc/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/fastqc/environment.yaml b/bio/fastqc/environment.yaml
index 7e06869876..6592b81aef 100644
--- a/bio/fastqc/environment.yaml
+++ b/bio/fastqc/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - fastqc ==0.11.9
+  - fastqc =0.11.9

From 6f5f48f79ce8c1fcbc5547aa85f2f3c6d0a0f6f3 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:49:06 +0200
Subject: [PATCH 19/34] perf: update bio/filtlong/environment.yaml. (#589)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/filtlong/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/filtlong/environment.yaml b/bio/filtlong/environment.yaml
index eb91090d49..35b245cb7f 100644
--- a/bio/filtlong/environment.yaml
+++ b/bio/filtlong/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - filtlong =0.2
+  - filtlong =0.2.1

From 5a1f5986710f8e1daa125b0959fe763362b99fb0 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:49:27 +0200
Subject: [PATCH 20/34] perf: update bio/freebayes/environment.yaml. (#590)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/freebayes/environment.yaml | 10 +++++-----
 1 file changed, 5 insertions(+), 5 deletions(-)

diff --git a/bio/freebayes/environment.yaml b/bio/freebayes/environment.yaml
index 8d7dd4b6e7..17a442b268 100644
--- a/bio/freebayes/environment.yaml
+++ b/bio/freebayes/environment.yaml
@@ -3,8 +3,8 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - freebayes =1.3.2
-  - bcftools =1.11
-  - parallel =20190522
-  - bedtools >=2.29
-  - sed =4.7
+  - freebayes =1.3.6
+  - bcftools =1.16
+  - parallel =20220922
+  - bedtools =2.30.0
+  - sed =4.8

From f60db66ecd380614e74251cbbf60244a113d3c99 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:49:47 +0200
Subject: [PATCH 21/34] perf: update bio/genefuse/environment.yaml. (#591)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/genefuse/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/genefuse/environment.yaml b/bio/genefuse/environment.yaml
index 3d74d5a4ad..fb8ce20286 100644
--- a/bio/genefuse/environment.yaml
+++ b/bio/genefuse/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - conda-forge
   - defaults
 dependencies:
-  - genefuse=0.6
+  - genefuse =0.8.0

From cb6b6167b09c4fc271275129651c3a0f641956f7 Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:50:05 +0200
Subject: [PATCH 22/34] perf: update bio/genomepy/environment.yaml. (#592)

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
---
 bio/genomepy/environment.yaml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/bio/genomepy/environment.yaml b/bio/genomepy/environment.yaml
index 65b326bfc3..9ebfc3d207 100644
--- a/bio/genomepy/environment.yaml
+++ b/bio/genomepy/environment.yaml
@@ -3,4 +3,4 @@ channels:
   - bioconda
   - nodefaults
 dependencies:
-  - genomepy ==0.14
+  - genomepy =0.14.0

From f618f0d24a99bc720febf72ae5b86a7999858bbf Mon Sep 17 00:00:00 2001
From: "github-actions[bot]"
 <41898282+github-actions[bot]@users.noreply.github.com>
Date: Wed, 12 Oct 2022 22:52:57 +0200
Subject: [PATCH 23/34] chore: release 1.15.2 (#578)

Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com>
---
 CHANGELOG.md | 21 +++++++++++++++++++++
 1 file changed, 21 insertions(+)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 7e630327cc..1b36ea309e 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -1,5 +1,26 @@
 # Changelog
 
+### [1.15.2](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.1...v1.15.2) (2022-10-12)
+
+
+### Performance Improvements
+
+* update bio/adapterremoval/environment.yaml. ([#573](https://www.github.com/snakemake/snakemake-wrappers/issues/573)) ([8cb0391](https://www.github.com/snakemake/snakemake-wrappers/commit/8cb03915ba46d0a7bf186b54882aa23c4b78f7ed))
+* update bio/assembly-stats/environment.yaml. ([#575](https://www.github.com/snakemake/snakemake-wrappers/issues/575)) ([2c12db0](https://www.github.com/snakemake/snakemake-wrappers/commit/2c12db04b2afae3e5ac1c56ee36baff66a8aff0e))
+* update bio/bellerophon/environment.yaml. ([#576](https://www.github.com/snakemake/snakemake-wrappers/issues/576)) ([fd06157](https://www.github.com/snakemake/snakemake-wrappers/commit/fd06157a4daec8fb6146bccb8925b00d025231e5))
+* update bio/bgzip/environment.yaml. ([#577](https://www.github.com/snakemake/snakemake-wrappers/issues/577)) ([36720ca](https://www.github.com/snakemake/snakemake-wrappers/commit/36720ca9a0d2c6093c7b8ebe26e0b78b5e90227b))
+* update bio/busco/environment.yaml. ([#581](https://www.github.com/snakemake/snakemake-wrappers/issues/581)) ([9825a5f](https://www.github.com/snakemake/snakemake-wrappers/commit/9825a5f882228f6a663408c21e9647ae31c00e53))
+* update bio/clustalo/environment.yaml. ([#582](https://www.github.com/snakemake/snakemake-wrappers/issues/582)) ([dc322c8](https://www.github.com/snakemake/snakemake-wrappers/commit/dc322c898466341a292b06354301f83f51c005cc))
+* update bio/delly/environment.yaml. ([#584](https://www.github.com/snakemake/snakemake-wrappers/issues/584)) ([0eb8ebc](https://www.github.com/snakemake/snakemake-wrappers/commit/0eb8ebc51a1f312836c4a3a7d3d2cfc16a4853c8))
+* update bio/fastp/environment.yaml. ([#585](https://www.github.com/snakemake/snakemake-wrappers/issues/585)) ([a573035](https://www.github.com/snakemake/snakemake-wrappers/commit/a573035813ba39d6bf47eb3bb9c5c68aecf074e0))
+* update bio/fastq_screen/environment.yaml. ([#586](https://www.github.com/snakemake/snakemake-wrappers/issues/586)) ([73a3d45](https://www.github.com/snakemake/snakemake-wrappers/commit/73a3d450ae1d7eff884eae89195758039aadd9c4))
+* update bio/fastqc/environment.yaml. ([#587](https://www.github.com/snakemake/snakemake-wrappers/issues/587)) ([9a0b30e](https://www.github.com/snakemake/snakemake-wrappers/commit/9a0b30e8131560d705c35d9a2eb68b986c743812))
+* update bio/fasttree/environment.yaml. ([#588](https://www.github.com/snakemake/snakemake-wrappers/issues/588)) ([b9b8a4e](https://www.github.com/snakemake/snakemake-wrappers/commit/b9b8a4e6ada4e3e2fcf6e266d7430ab51ab978eb))
+* update bio/filtlong/environment.yaml. ([#589](https://www.github.com/snakemake/snakemake-wrappers/issues/589)) ([3394085](https://www.github.com/snakemake/snakemake-wrappers/commit/33940856b332699f73410b5b49d6b387b817bd1b))
+* update bio/freebayes/environment.yaml. ([#590](https://www.github.com/snakemake/snakemake-wrappers/issues/590)) ([17c9581](https://www.github.com/snakemake/snakemake-wrappers/commit/17c95816b6158eb7c2db56bc1b7c257357359441))
+* update bio/genefuse/environment.yaml. ([#591](https://www.github.com/snakemake/snakemake-wrappers/issues/591)) ([63c620d](https://www.github.com/snakemake/snakemake-wrappers/commit/63c620d40435fc9306d0c5e63e06c79287e537c8))
+* update bio/genomepy/environment.yaml. ([#592](https://www.github.com/snakemake/snakemake-wrappers/issues/592)) ([4cfb29b](https://www.github.com/snakemake/snakemake-wrappers/commit/4cfb29b97770555af53b16523b14b033d0a1f2fb))
+
 ### [1.15.1](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.0...v1.15.1) (2022-10-11)
 
 

From 141e09e7114641ecc94eb83bc394ee1f8e669af9 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Felix=20M=C3=B6lder?= <felix.moelder@uni-due.de>
Date: Thu, 13 Oct 2022 11:42:49 +0200
Subject: [PATCH 24/34] fix: set RG tag (#593)

---
 .../meta.yaml                                       |   0
 .../test/Snakefile                                  |   1 +
 .../test/mapped/sampleA.marked.bam                  | Bin
 .../test/resources/genome.fa                        |   0
 .../test/resources/genome.fa.amb                    |   0
 .../test/resources/genome.fa.ann                    |   0
 .../test/resources/genome.fa.bwt                    | Bin
 .../test/resources/genome.fa.pac                    | Bin
 .../test/resources/genome.fa.sa                     | Bin
 .../used_wrappers.yaml                              |   0
 test.py                                             |   2 +-
 11 files changed, 2 insertions(+), 1 deletion(-)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/meta.yaml (100%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/Snakefile (98%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/mapped/sampleA.marked.bam (100%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa (100%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.amb (100%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.ann (100%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.bwt (100%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.pac (100%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.sa (100%)
 rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/used_wrappers.yaml (100%)

diff --git a/meta/bio/rbt_calc_consensus/meta.yaml b/meta/bio/calc_consensus_reads/meta.yaml
similarity index 100%
rename from meta/bio/rbt_calc_consensus/meta.yaml
rename to meta/bio/calc_consensus_reads/meta.yaml
diff --git a/meta/bio/rbt_calc_consensus/test/Snakefile b/meta/bio/calc_consensus_reads/test/Snakefile
similarity index 98%
rename from meta/bio/rbt_calc_consensus/test/Snakefile
rename to meta/bio/calc_consensus_reads/test/Snakefile
index c67346e17e..f1df2b9562 100644
--- a/meta/bio/rbt_calc_consensus/test/Snakefile
+++ b/meta/bio/calc_consensus_reads/test/Snakefile
@@ -29,6 +29,7 @@ rule map_consensus_reads:
     output:
         temp("results/consensus_mapped/{sample}.{read_type}.bam"),
     params:
+        extra=r"-R '@RG\tID:{sample}\tSM:{sample}'",
         index=lambda w, input: os.path.splitext(input.idx[0])[0],
         sort="samtools",
         sort_order="coordinate",
diff --git a/meta/bio/rbt_calc_consensus/test/mapped/sampleA.marked.bam b/meta/bio/calc_consensus_reads/test/mapped/sampleA.marked.bam
similarity index 100%
rename from meta/bio/rbt_calc_consensus/test/mapped/sampleA.marked.bam
rename to meta/bio/calc_consensus_reads/test/mapped/sampleA.marked.bam
diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa b/meta/bio/calc_consensus_reads/test/resources/genome.fa
similarity index 100%
rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa
rename to meta/bio/calc_consensus_reads/test/resources/genome.fa
diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.amb b/meta/bio/calc_consensus_reads/test/resources/genome.fa.amb
similarity index 100%
rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.amb
rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.amb
diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.ann b/meta/bio/calc_consensus_reads/test/resources/genome.fa.ann
similarity index 100%
rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.ann
rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.ann
diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.bwt b/meta/bio/calc_consensus_reads/test/resources/genome.fa.bwt
similarity index 100%
rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.bwt
rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.bwt
diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.pac b/meta/bio/calc_consensus_reads/test/resources/genome.fa.pac
similarity index 100%
rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.pac
rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.pac
diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.sa b/meta/bio/calc_consensus_reads/test/resources/genome.fa.sa
similarity index 100%
rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.sa
rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.sa
diff --git a/meta/bio/rbt_calc_consensus/used_wrappers.yaml b/meta/bio/calc_consensus_reads/used_wrappers.yaml
similarity index 100%
rename from meta/bio/rbt_calc_consensus/used_wrappers.yaml
rename to meta/bio/calc_consensus_reads/used_wrappers.yaml
diff --git a/test.py b/test.py
index 5148b7e5d0..3b4304f899 100644
--- a/test.py
+++ b/test.py
@@ -4851,6 +4851,6 @@ def test_collapse_reads_to_fragments_bam():
 @skip_if_not_modified
 def test_calc_consensus_reads():
     run(
-        "meta/bio/rbt_calc_consensus/",
+        "meta/bio/calc_consensus_reads/",
         ["snakemake", "--cores", "1", "--use-conda", "-F", "results/consensus/sampleA.bam"],
     )
\ No newline at end of file

From 278f5086057b2c1c16e6f42c6c0830943483d24b Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Johannes=20K=C3=B6ster?= <johannes.koester@uni-due.de>
Date: Thu, 13 Oct 2022 11:45:20 +0200
Subject: [PATCH 25/34] Update conventional-prs.yml

---
 .github/workflows/conventional-prs.yml | 1 -
 1 file changed, 1 deletion(-)

diff --git a/.github/workflows/conventional-prs.yml b/.github/workflows/conventional-prs.yml
index 9ee4613cc3..c777f4b2de 100644
--- a/.github/workflows/conventional-prs.yml
+++ b/.github/workflows/conventional-prs.yml
@@ -14,4 +14,3 @@ jobs:
       - uses: amannn/action-semantic-pull-request@v3.4.0
         env:
           GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
-          validateSingleCommit: true
\ No newline at end of file

From de6ce8530baa67eaa14474890018ea9bdaa808eb Mon Sep 17 00:00:00 2001
From: "snakedeploy-bot[bot]"
 <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Date: Thu, 13 Oct 2022 12:42:10 +0200
Subject: [PATCH 26/34] perf: autobump bio/deepvariant (#583)
MIME-Version: 1.0
Content-Type: text/plain; charset=UTF-8
Content-Transfer-Encoding: 8bit

Automatic update of bio/deepvariant.

Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com>
Co-authored-by: Johannes Köster <johannes.koester@uni-due.de>
---
 bio/deepvariant/environment.yaml | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/bio/deepvariant/environment.yaml b/bio/deepvariant/environment.yaml
index 983e6a53b4..a8b8946695 100644
--- a/bio/deepvariant/environment.yaml
+++ b/bio/deepvariant/environment.yaml
@@ -1,6 +1,7 @@
 channels:
   - conda-forge
   - bioconda
+  - nodefaults
 dependencies:
   - deepvariant =1.4
-  - numpy
+  - numpy =1.23

From f9332c21e5781ce8adecf20913c1caa4bd86d265 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Christopher=20Schr=C3=B6der?=
 <christopher.schroeder@tu-dortmund.de>
Date: Thu, 13 Oct 2022 13:59:03 +0200
Subject: [PATCH 27/34] feat: bazam wrapper (#580)

<!-- Ensure that the PR title follows conventional commit style (<type>:
<description>)-->
<!-- Possible types are here:
https://github.com/commitizen/conventional-commit-types/blob/master/index.json
-->

### Description

<!-- Add a description of your PR here-->

### QC
<!-- Make sure that you can tick the boxes below. -->

* [x] I confirm that:

For all wrappers added by this PR,

* there is a test case which covers any introduced changes,
* `input:` and `output:` file paths in the resulting rule can be changed
arbitrarily,
* either the wrapper can only use a single core, or the example rule
contains a `threads: x` statement with `x` being a reasonable default,
* rule names in the test case are in
[snake_case](https://en.wikipedia.org/wiki/Snake_case) and somehow tell
what the rule is about or match the tools purpose or name (e.g.,
`map_reads` for a step that maps reads),
* all `environment.yaml` specifications follow [the respective best
practices](https://stackoverflow.com/a/64594513/2352071),
* wherever possible, command line arguments are inferred and set
automatically (e.g. based on file extensions in `input:` or `output:`),
* all fields of the example rules in the `Snakefile`s and their entries
are explained via comments (`input:`/`output:`/`params:` etc.),
* `stderr` and/or `stdout` are logged correctly (`log:`), depending on
the wrapped tool,
* temporary files are either written to a unique hidden folder in the
working directory, or (better) stored where the Python function
`tempfile.gettempdir()` points to (see
[here](https://docs.python.org/3/library/tempfile.html#tempfile.gettempdir);
this also means that using any Python `tempfile` default behavior
works),
* the `meta.yaml` contains a link to the documentation of the respective
tool or command,
* `Snakefile`s pass the linting (`snakemake --lint`),
* `Snakefile`s are formatted with
[snakefmt](https://github.com/snakemake/snakefmt),
* Python wrapper scripts are formatted with
[black](https://black.readthedocs.io).
* Conda environments use a minimal amount of channels, in recommended
ordering. E.g. for bioconda, use (conda-forge, bioconda, nodefaults, as
conda-forge should have highest priority and defaults channels are
usually not needed because most packages are in conda-forge nowadays).
---
 bio/bazam/environment.yaml        |   7 ++++++
 bio/bazam/meta.yaml               |  10 +++++++++
 bio/bazam/test/Snakefile          |  28 ++++++++++++++++++++++++
 bio/bazam/test/genome.fasta       |   2 ++
 bio/bazam/test/mapped/a.bam       | Bin 0 -> 334 bytes
 bio/bazam/test/mapped/a.bam.bai   | Bin 0 -> 24 bytes
 bio/bazam/test/mapped/a.cram      | Bin 0 -> 955 bytes
 bio/bazam/test/mapped/a.cram.crai | Bin 0 -> 41 bytes
 bio/bazam/wrapper.py              |  34 ++++++++++++++++++++++++++++++
 test.py                           |  14 ++++++++++++
 10 files changed, 95 insertions(+)
 create mode 100644 bio/bazam/environment.yaml
 create mode 100644 bio/bazam/meta.yaml
 create mode 100644 bio/bazam/test/Snakefile
 create mode 100644 bio/bazam/test/genome.fasta
 create mode 100644 bio/bazam/test/mapped/a.bam
 create mode 100644 bio/bazam/test/mapped/a.bam.bai
 create mode 100644 bio/bazam/test/mapped/a.cram
 create mode 100644 bio/bazam/test/mapped/a.cram.crai
 create mode 100644 bio/bazam/wrapper.py

diff --git a/bio/bazam/environment.yaml b/bio/bazam/environment.yaml
new file mode 100644
index 0000000000..8ae1bbb412
--- /dev/null
+++ b/bio/bazam/environment.yaml
@@ -0,0 +1,7 @@
+channels:
+  - conda-forge
+  - bioconda
+  - nodefaults
+dependencies:
+  - bazam =1.0
+  - snakemake-wrapper-utils ==0.5
\ No newline at end of file
diff --git a/bio/bazam/meta.yaml b/bio/bazam/meta.yaml
new file mode 100644
index 0000000000..2abe5a5d51
--- /dev/null
+++ b/bio/bazam/meta.yaml
@@ -0,0 +1,10 @@
+name: "bazam"
+description: Bazam is a smarter way to realign reads from one genome to another. If you've tried to use Picard SAMtoFASTQ or samtools bam2fq before and ended up unsatisfied with complicated, long running inefficient pipelines, bazam might be what you wanted. Bazam will output FASTQ in a form that can stream directly into common aligners such as BWA or Bowtie2, so that you can quickly and easily realign reads without extraction to any intermediate format. Bazam can target a specific region of the genome, specified as a region or a gene name if you prefer.
+url: https://github.com/ssadedin/bazam
+authors:
+  - Christopher Schröder
+input:
+  - BAM/CRAM file
+  - reference genome
+output:
+  - fastq file
diff --git a/bio/bazam/test/Snakefile b/bio/bazam/test/Snakefile
new file mode 100644
index 0000000000..3846405620
--- /dev/null
+++ b/bio/bazam/test/Snakefile
@@ -0,0 +1,28 @@
+rule bazam_interleaved:
+    input:
+        bam="mapped/{sample}.bam",
+        bai="mapped/{sample}.bam.bai",
+    output:
+        reads="results/reads/{sample}.fastq.gz",
+    resources:
+        mem_mb=12000,
+    log:
+        "logs/bazam/{sample}.log",
+    wrapper:
+        "master/bio/bazam"
+
+
+rule bazam_separated:
+    input:
+        bam="mapped/{sample}.cram",
+        bai="mapped/{sample}.cram.crai",
+        reference="genome.fasta",
+    output:
+        r1="results/reads/{sample}.r1.fastq.gz",
+        r2="results/reads/{sample}.r2.fastq.gz",
+    resources:
+        mem_mb=12000,
+    log:
+        "logs/bazam/{sample}.log",
+    wrapper:
+        "master/bio/bazam"
diff --git a/bio/bazam/test/genome.fasta b/bio/bazam/test/genome.fasta
new file mode 100644
index 0000000000..11d25dda64
--- /dev/null
+++ b/bio/bazam/test/genome.fasta
@@ -0,0 +1,2 @@
+>Sheila
+GCTAGCTCAGAAAAAAAAAA
diff --git a/bio/bazam/test/mapped/a.bam b/bio/bazam/test/mapped/a.bam
new file mode 100644
index 0000000000000000000000000000000000000000..243bc19d34af48ee291f96ff4b05f4462a632d81
GIT binary patch
literal 334
zcmb2|=3rp}f&Xj_PR>jWPZ&ZcIA$Mm5NK6jzG>m{e+@sGH=A)UP4&Mhwj{x6mV<ws
zTg>VQC708#?AP}U`1oyKV#WK9X_u8MeHcDHJ8iNwe_P`A^vxQ3tNlJ#<=NTW%wG0k
z&a<lytA!`C6fV=s|F!$eIjh+-zaRbDA;jYOk$2^>J@fRpevit^Z?k`B?zKVs-IR~^
zA9l^&aF*@g?oHA^C*9eY(erzq|Gt;6*14u_p1$$eQ|A8N1x`wL`L_M&5((Uqd${UQ
z+0iDKj|<*9W-51W&YY;m@PUEhvBU=!hV%r+H?8W73=HyUp7deZoRpC8gP+xhN6v|d
zXCKcSk0c%-Xyb9x>*D1Rcp&lSjDR2zKarbyBB6ER?&&Od88&CF-B|++D0IW58JNKV
G2qFLsfQxAW

literal 0
HcmV?d00001

diff --git a/bio/bazam/test/mapped/a.bam.bai b/bio/bazam/test/mapped/a.bam.bai
new file mode 100644
index 0000000000000000000000000000000000000000..a9b9979fed416428b1762d263d09d49bb00e5119
GIT binary patch
literal 24
RcmZ>A^kigYKmaBv695vP0MP&d

literal 0
HcmV?d00001

diff --git a/bio/bazam/test/mapped/a.cram b/bio/bazam/test/mapped/a.cram
new file mode 100644
index 0000000000000000000000000000000000000000..0499f5980cb387f62bdc0e03c8516f00deb0bb1d
GIT binary patch
literal 955
zcmZ<`a`a_p&}F~`HyL4KOiT=oCd%re`aqFJ&BjOa-5e09|F!+Td4~){T3%k7^C<Q}
zS+0}wUaxwU5YC`kTVgj>`uTJoFzn^^u+2Fi#CqiYqTMr>FaMcVmv1#!rCzym)u){+
zr+K)ooU}dVPIzJDH0GWXlgX_bzJgyD{os3i&w+c-^^Gd>GapHBe`0#APyF+;PX`O*
zA0LW{k=T`6u+^yd`L3dv$NW)pJ^X)8UpXgb<}ANqc8c?-PirPTNp8KHvZ=VL`-+tI
zNfq0d=R-WzW-9nEek{0VqXRQfL)wIt!<iYImo4ONF6J{~^FBYZbMAk;s-552H@QpC
ziT*XM=F;SDv8K*{`;I+iHk*2rX=&oV?pBEv%(vI+TN?F>X_UU+5XEk_nNd#u*mWDV
zb)D{i<v)scE%UA4FH_z3?jK{amB-6Rz`%+ywJrgMRKu)>S+KAie00@qPsd82WB&sI
zKLaBZ10N@2!;KrVcU2h}85+(uoRwe+abb51c8&;kW(f9`27w?yM#ligh8`g&H%3N&
zXE$aRMrKBaARi#j&dA^x0HlGMgWMssFG!w=k-;yRnS&8*4Ui306A}zj69Uo;)Z^*L
z%EZ9y<jBY<=j6n~#>l9}$f)WY2$2i|Npc4UGcxi7c_PdTb_NRbsWLqPx{!qjsFV?C
z5(|j;0O)Ka5g>1_Gv^%!CI%fHxOdsvxOw>HV5%X)XtAUlVS1i{6)33B{^uhD3pWdk
zA%h_UpV9mV1{NMZK2+7uW_Wfou<$c8`!@7mdHU=r1B)CVpQE$8yR%~ml$zq=Yrp_@
zATVn&y!-DV2;>1B2jYEJ<9o~xG!g8O2d@5ZAk!HcSohxa2U2Wopg>||c$duR4FJsz
B^`-y-

literal 0
HcmV?d00001

diff --git a/bio/bazam/test/mapped/a.cram.crai b/bio/bazam/test/mapped/a.cram.crai
new file mode 100644
index 0000000000000000000000000000000000000000..b34400a88428f3344ef07241df382706c32385af
GIT binary patch
literal 41
scmb2|=3oE==1ZneOdgm#F)`ipz{JSpv5ATC6DAG=h9idYuY`dr0QyM`Q2+n{

literal 0
HcmV?d00001

diff --git a/bio/bazam/wrapper.py b/bio/bazam/wrapper.py
new file mode 100644
index 0000000000..a944742972
--- /dev/null
+++ b/bio/bazam/wrapper.py
@@ -0,0 +1,34 @@
+__author__ = "Christopher Schröder"
+__copyright__ = "Copyright 2022, Christopher Schröder"
+__email__ = "christopher.schroeder@tu-dortmund.de"
+__license__ = "MIT"
+
+from snakemake.shell import shell
+from snakemake_wrapper_utils.java import get_java_opts
+
+java_opts = get_java_opts(snakemake)
+
+log = snakemake.log_fmt_shell(stdout=False, stderr=True)
+bam = snakemake.input.bam
+
+# Extra parameters default value is an empty string
+extra = snakemake.params.get("extra", "")
+
+if bam.endswith(".cram"):
+    if not (reference := snakemake.input.get("reference", "")):
+        raise ValueError(
+            "input 'reference' is required when working with CRAM input files"
+        )
+    reference_cmd = f"-Dsamjdk.reference_fasta={reference}"
+else:
+    reference_cmd = ""
+
+# Extract arguments.
+if reads := snakemake.output.get("reads", ""):
+    out_cmd = f"-o {reads}"
+elif (r1 := snakemake.output.get("r1", "")) and (r2 := snakemake.output.get("r2", "")):
+    out_cmd = f"-r1 {r1} -r2 {r2}"
+else:
+    raise ValueError("either 'reads' or 'r1' and 'r2' must be specified in output")
+
+shell("(bazam {java_opts} {reference_cmd} {extra} -bam {bam} {out_cmd}) {log}")
diff --git a/test.py b/test.py
index 3b4304f899..575571f57e 100644
--- a/test.py
+++ b/test.py
@@ -4853,4 +4853,18 @@ def test_calc_consensus_reads():
     run(
         "meta/bio/calc_consensus_reads/",
         ["snakemake", "--cores", "1", "--use-conda", "-F", "results/consensus/sampleA.bam"],
+    )
+
+@skip_if_not_modified
+def test_bazam_interleaved():
+    run(
+        "bio/bazam",
+        ["snakemake", "--cores", "1", "--use-conda", "-F", "results/reads/a.fastq.gz"],
+    )
+
+@skip_if_not_modified
+def test_bazam_separated():
+    run(
+        "bio/bazam",
+        ["snakemake", "--cores", "1", "--use-conda", "-F", "results/reads/a.r1.fastq.gz"],
     )
\ No newline at end of file

From 39c488da6354d2dc0e6c8924ecedabdd2bba2cb2 Mon Sep 17 00:00:00 2001
From: "github-actions[bot]"
 <41898282+github-actions[bot]@users.noreply.github.com>
Date: Thu, 13 Oct 2022 14:04:37 +0200
Subject: [PATCH 28/34] chore: release 1.16.0 (#596)

:robot: I have created a release \*beep\* \*boop\*
---
##
[1.16.0](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.2...v1.16.0)
(2022-10-13)


### Features

* bazam wrapper
([#580](https://www.github.com/snakemake/snakemake-wrappers/issues/580))
([17e58e6](https://www.github.com/snakemake/snakemake-wrappers/commit/17e58e6f254ce429b3b76b841df29b573949e278))


### Bug Fixes

* set RG tag
([#593](https://www.github.com/snakemake/snakemake-wrappers/issues/593))
([506a083](https://www.github.com/snakemake/snakemake-wrappers/commit/506a08391b56d4b53edda2c6555b9b9d404d4f94))


### Performance Improvements

* autobump bio/deepvariant
([#583](https://www.github.com/snakemake/snakemake-wrappers/issues/583))
([9b7c4fe](https://www.github.com/snakemake/snakemake-wrappers/commit/9b7c4feec69d05fc7d6286dcdfdc65802cb93317))
---


This PR was generated with [Release
Please](https://github.com/googleapis/release-please). See
[documentation](https://github.com/googleapis/release-please#release-please).

Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com>
---
 CHANGELOG.md | 17 +++++++++++++++++
 1 file changed, 17 insertions(+)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 1b36ea309e..802608bf48 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -1,5 +1,22 @@
 # Changelog
 
+## [1.16.0](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.2...v1.16.0) (2022-10-13)
+
+
+### Features
+
+* bazam wrapper ([#580](https://www.github.com/snakemake/snakemake-wrappers/issues/580)) ([17e58e6](https://www.github.com/snakemake/snakemake-wrappers/commit/17e58e6f254ce429b3b76b841df29b573949e278))
+
+
+### Bug Fixes
+
+* set RG tag ([#593](https://www.github.com/snakemake/snakemake-wrappers/issues/593)) ([506a083](https://www.github.com/snakemake/snakemake-wrappers/commit/506a08391b56d4b53edda2c6555b9b9d404d4f94))
+
+
+### Performance Improvements
+
+* autobump bio/deepvariant ([#583](https://www.github.com/snakemake/snakemake-wrappers/issues/583)) ([9b7c4fe](https://www.github.com/snakemake/snakemake-wrappers/commit/9b7c4feec69d05fc7d6286dcdfdc65802cb93317))
+
 ### [1.15.2](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.1...v1.15.2) (2022-10-12)
 
 

From 77a2f4c468c6a5d8a5ae1ce666a441efc34f6a7c Mon Sep 17 00:00:00 2001
From: tdayris <thibault.dayris@gustaveroussy.fr>
Date: Tue, 11 Apr 2023 09:23:15 +0200
Subject: [PATCH 29/34] revert

---
 utils/datavzrd/environment.yaml | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/utils/datavzrd/environment.yaml b/utils/datavzrd/environment.yaml
index 3024650a12..19eb1b9e57 100644
--- a/utils/datavzrd/environment.yaml
+++ b/utils/datavzrd/environment.yaml
@@ -1,5 +1,5 @@
 channels:
-- conda-forge
-- nodefaults
+  - conda-forge
+  - nodefaults
 dependencies:
   - datavzrd =2.18.1

From 939082e86212ec58f64fc93e60c04bf43bb75db6 Mon Sep 17 00:00:00 2001
From: tdayris <thibault.dayris@gustaveroussy.fr>
Date: Fri, 14 Apr 2023 13:52:40 +0200
Subject: [PATCH 30/34] revert

---
 utils/datavzrd/environment.yaml | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/utils/datavzrd/environment.yaml b/utils/datavzrd/environment.yaml
index 3024650a12..19eb1b9e57 100644
--- a/utils/datavzrd/environment.yaml
+++ b/utils/datavzrd/environment.yaml
@@ -1,5 +1,5 @@
 channels:
-- conda-forge
-- nodefaults
+  - conda-forge
+  - nodefaults
 dependencies:
   - datavzrd =2.18.1

From a379390c7fcae1020bc4b01184d26a6dfc3eab0e Mon Sep 17 00:00:00 2001
From: tdayris <thibault.dayris@gustaveroussy.fr>
Date: Mon, 10 Jul 2023 10:12:50 +0200
Subject: [PATCH 31/34] initial commit

---
 meta/bio/bowtie2_sambamba/meta.yaml           |  22 ++++
 .../bowtie2_sambamba/test/Sample1.R1.fastq    |  32 ++++++
 .../bowtie2_sambamba/test/Sample1.R2.fastq    |  32 ++++++
 meta/bio/bowtie2_sambamba/test/Snakefile      | 102 ++++++++++++++++++
 meta/bio/bowtie2_sambamba/test/genome.fasta   |   3 +
 meta/bio/bowtie2_sambamba/used_wrappers.yaml  |   7 ++
 test.py                                       |  16 +++
 7 files changed, 214 insertions(+)
 create mode 100644 meta/bio/bowtie2_sambamba/meta.yaml
 create mode 100644 meta/bio/bowtie2_sambamba/test/Sample1.R1.fastq
 create mode 100644 meta/bio/bowtie2_sambamba/test/Sample1.R2.fastq
 create mode 100644 meta/bio/bowtie2_sambamba/test/Snakefile
 create mode 100644 meta/bio/bowtie2_sambamba/test/genome.fasta
 create mode 100644 meta/bio/bowtie2_sambamba/used_wrappers.yaml

diff --git a/meta/bio/bowtie2_sambamba/meta.yaml b/meta/bio/bowtie2_sambamba/meta.yaml
new file mode 100644
index 0000000000..c552e95943
--- /dev/null
+++ b/meta/bio/bowtie2_sambamba/meta.yaml
@@ -0,0 +1,22 @@
+name: Bowtie2 Sambamba
+url: http://lomereiter.github.io/sambamba/
+description: >
+  Map reads with Bowtie 2, and post-process alignments with Sambamba.
+
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Step           | Tool     | Reason                                                                                       |
+  +================+==========+==============================================================================================+
+  | Indexation     | Bowtie 2 | Create genome sequence index                                                                 |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Mapping        | Bowtie 2 | Perform read mapping                                                                         |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Sort           | Sambamba | Perform sort based on mapping position                                                       |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Quality filter | Sambamba | Perform mapping quality filter                                                               |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Deduplication  | Sambamba | Identify possible sequencing duplicates                                                      |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+  | Indexation     | Sambamba | Index deduplicated reads                                                                     |
+  +----------------+----------+----------------------------------------------------------------------------------------------+
+authors:
+  - Thibault Dayris
diff --git a/meta/bio/bowtie2_sambamba/test/Sample1.R1.fastq b/meta/bio/bowtie2_sambamba/test/Sample1.R1.fastq
new file mode 100644
index 0000000000..b2daf11aaa
--- /dev/null
+++ b/meta/bio/bowtie2_sambamba/test/Sample1.R1.fastq
@@ -0,0 +1,32 @@
+@1
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@2
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@3
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@4
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@5
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@6
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@7
+GCTGCTATGGCTATAGCTCTA
++
+IIIIIIIIIIIIIIIIIIIII
+@8
+GTATCGATCCGATTA
++
+IIIIIIIIIIIIIII
\ No newline at end of file
diff --git a/meta/bio/bowtie2_sambamba/test/Sample1.R2.fastq b/meta/bio/bowtie2_sambamba/test/Sample1.R2.fastq
new file mode 100644
index 0000000000..46bb45e2d6
--- /dev/null
+++ b/meta/bio/bowtie2_sambamba/test/Sample1.R2.fastq
@@ -0,0 +1,32 @@
+@1
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@2
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@3
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@4
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@5
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@6
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@7
+CTCGATATCGCGCTACGATCC
++
+IIIIIIIIIIIIIIIIIIIII
+@8
+ATATCGATCGACGAT
++
+IIIIIIIIIIIIIII
\ No newline at end of file
diff --git a/meta/bio/bowtie2_sambamba/test/Snakefile b/meta/bio/bowtie2_sambamba/test/Snakefile
new file mode 100644
index 0000000000..2d531bb745
--- /dev/null
+++ b/meta/bio/bowtie2_sambamba/test/Snakefile
@@ -0,0 +1,102 @@
+rule bowtie2_build:
+    input:
+        ref="genome.fasta",
+    output:
+        multiext(
+            "genome",
+            ".1.bt2",
+            ".2.bt2",
+            ".3.bt2",
+            ".4.bt2",
+            ".rev.1.bt2",
+            ".rev.2.bt2",
+        ),
+    log:
+        "logs/bowtie2_build/build.log",
+    params:
+        extra="",
+    threads: 8
+    wrapper:
+        "master/bio/bowtie2/build"
+
+
+rule bowtie2_alignment:
+    input:
+        sample=["{sample}.R1.fastq", "{sample}.R2.fastq"],
+        idx=multiext(
+            "genome",
+            ".1.bt2",
+            ".2.bt2",
+            ".3.bt2",
+            ".4.bt2",
+            ".rev.1.bt2",
+            ".rev.2.bt2",
+        ),
+    output:
+        "mapped/{sample}.bam",
+    log:
+        "logs/bowtie2/{sample}.log",
+    params:
+        extra="",
+    threads: 8
+    wrapper:
+        "master/bio/bowtie2/align"
+
+
+rule sambamba_sort:
+    input:
+        "mapped/{sample}.bam",
+    output:
+        "mapped/{sample}.sorted.bam",
+    params:
+        "",
+    log:
+        "logs/sambamba-sort/{sample}.log",
+    threads: 8
+    wrapper:
+        "master/bio/sambamba/sort"
+
+
+rule sambamba_view:
+    input:
+        "mapped/{sample}.sorted.bam",
+    output:
+        "mapped/{sample}.filtered.bam",
+    params:
+        extra=(
+            " --format 'bam' "
+            "--filter 'mapping_quality >= 30 and not (unmapped or mate_is_unmapped)' "
+        ),
+    log:
+        "logs/sambamba-view/{sample}.log",
+    threads: 8
+    wrapper:
+        "master/bio/sambamba/view"
+
+
+rule sambamba_markdup:
+    input:
+        "mapped/{sample}.filtered.bam",
+    output:
+        "mapped/{sample}.rmdup.bam",
+    params:
+        extra=" --remove-duplicates ",  # optional parameters
+    log:
+        "logs/sambamba-markdup/{sample}.log",
+    threads: 8
+    wrapper:
+        "master/bio/sambamba/markdup"
+
+
+rule sambamba_index:
+    input:
+        "mapped/{sample}.rmdup.bam",
+    output:
+        "mapped/{sample}.rmdup.bam.bai",
+    params:
+        extra="",
+    log:
+        "logs/sambamba-index/{sample}.log",
+    threads: 8
+    wrapper:
+        "master/bio/sambamba/index"
diff --git a/meta/bio/bowtie2_sambamba/test/genome.fasta b/meta/bio/bowtie2_sambamba/test/genome.fasta
new file mode 100644
index 0000000000..b82a52922f
--- /dev/null
+++ b/meta/bio/bowtie2_sambamba/test/genome.fasta
@@ -0,0 +1,3 @@
+>FakeChrom
+ATCGATGCTGCTATAGCTATAGCTCTAGATCTGATCTGCTAGTATCGATCCGATTATTAGCGCGATTATAGCGTAGTCA
+ATCGATCTCGATATCGCGCTACGATCCGCGCGCGCGCGCGCATTATATCGATCGACGATGCTGCTAGCTAGCTGCTAGC
\ No newline at end of file
diff --git a/meta/bio/bowtie2_sambamba/used_wrappers.yaml b/meta/bio/bowtie2_sambamba/used_wrappers.yaml
new file mode 100644
index 0000000000..2a7d6fe9ae
--- /dev/null
+++ b/meta/bio/bowtie2_sambamba/used_wrappers.yaml
@@ -0,0 +1,7 @@
+wrappers:
+  - bio/bowtie2/build
+  - bio/bowtie2/align
+  - bio/sambamba/sort
+  - bio/sambamba/view
+  - bio/sambamba/markdup
+  - bio/sambamba/index
\ No newline at end of file
diff --git a/test.py b/test.py
index 7300eb3ecc..80740cd576 100644
--- a/test.py
+++ b/test.py
@@ -5584,6 +5584,22 @@ def test_calc_consensus_reads():
     )
 
 
+
+@skip_if_not_modified
+def test_bowtie2_sambamba_meta():
+    run(
+        "meta/bio/bowtie2_sambamba",
+        [
+            "snakemake",
+            "--cores",
+            "2",
+            "--use-conda",
+            "-F",
+            "mapped/Sample1.rmdup.bam.bai"
+        ]
+    )
+
+
 @skip_if_not_modified
 def test_bazam_interleaved():
     run(

From b2d8ef334bc8a92b52f4e43ce4153087944eb3e5 Mon Sep 17 00:00:00 2001
From: tdayris <thibault.dayris@gustaveroussy.fr>
Date: Mon, 10 Jul 2023 14:04:52 +0200
Subject: [PATCH 32/34] add read groups

---
 meta/bio/bowtie2_sambamba/test/Snakefile | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/meta/bio/bowtie2_sambamba/test/Snakefile b/meta/bio/bowtie2_sambamba/test/Snakefile
index 2d531bb745..13a52e28b0 100644
--- a/meta/bio/bowtie2_sambamba/test/Snakefile
+++ b/meta/bio/bowtie2_sambamba/test/Snakefile
@@ -37,7 +37,7 @@ rule bowtie2_alignment:
     log:
         "logs/bowtie2/{sample}.log",
     params:
-        extra="",
+        extra="--rg-id {sample} --rg SM:{sample}",
     threads: 8
     wrapper:
         "master/bio/bowtie2/align"

From 33a958589848bee3395dbd73024a82064e17592d Mon Sep 17 00:00:00 2001
From: tdayris <thibault.dayris@gustaveroussy.fr>
Date: Mon, 10 Jul 2023 14:39:15 +0200
Subject: [PATCH 33/34] add rg info

---
 meta/bio/bowtie2_sambamba/test/Snakefile | 5 ++++-
 1 file changed, 4 insertions(+), 1 deletion(-)

diff --git a/meta/bio/bowtie2_sambamba/test/Snakefile b/meta/bio/bowtie2_sambamba/test/Snakefile
index 13a52e28b0..28776d230c 100644
--- a/meta/bio/bowtie2_sambamba/test/Snakefile
+++ b/meta/bio/bowtie2_sambamba/test/Snakefile
@@ -37,7 +37,10 @@ rule bowtie2_alignment:
     log:
         "logs/bowtie2/{sample}.log",
     params:
-        extra="--rg-id {sample} --rg SM:{sample}",
+        extra=(
+            " --rg-id {sample} "
+            "--rg 'SM:{sample} LB:FakeLib PU:FakePU.1.{sample} PL:ILLUMINA' "
+        ),
     threads: 8
     wrapper:
         "master/bio/bowtie2/align"

From 8a7d7f507fd2df48ddfa0548f72039c1088c11e4 Mon Sep 17 00:00:00 2001
From: tdayris <thibault.dayris@gustaveroussy.fr>
Date: Thu, 27 Jul 2023 16:29:21 +0200
Subject: [PATCH 34/34] adding temp flags

---
 meta/bio/bowtie2_sambamba/test/Snakefile | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/meta/bio/bowtie2_sambamba/test/Snakefile b/meta/bio/bowtie2_sambamba/test/Snakefile
index 28776d230c..adc90c4d3a 100644
--- a/meta/bio/bowtie2_sambamba/test/Snakefile
+++ b/meta/bio/bowtie2_sambamba/test/Snakefile
@@ -33,7 +33,7 @@ rule bowtie2_alignment:
             ".rev.2.bt2",
         ),
     output:
-        "mapped/{sample}.bam",
+        temp("mapped/{sample}.bam"),
     log:
         "logs/bowtie2/{sample}.log",
     params:
@@ -50,7 +50,7 @@ rule sambamba_sort:
     input:
         "mapped/{sample}.bam",
     output:
-        "mapped/{sample}.sorted.bam",
+        temp("mapped/{sample}.sorted.bam"),
     params:
         "",
     log:
@@ -64,7 +64,7 @@ rule sambamba_view:
     input:
         "mapped/{sample}.sorted.bam",
     output:
-        "mapped/{sample}.filtered.bam",
+        temp("mapped/{sample}.filtered.bam"),
     params:
         extra=(
             " --format 'bam' "