SYNOPSIS
QUEEN [--help]
(--protocol_description | --script_description | --feature_description | --dnamap_visualization | --protocolflow_visualization | --cutdna | --cropdna | --flipdna | --joindna)
[--input INPUT [INPUT ...]] [--output OUTPUT] [--separation SEPARATION] [--positions POSITIONS [POSITIONS ...]]
[--start START] [--end END] [--attribute ATTRIBUTE [ATTRIBUTE ...]] [--query QUERY [QUERY ...]]
[--columns COLUMNS [COLUMNS ...]] [--sequence] [--rcseq] [--linebreak LINEBREAK] [--map_view MAP_VIEW]
OPTIONS:
-h, --help show this help message and exit
QUEEN function options: Please choose only one option from the following ones.
--get_gbk, -gg
Download a GenBank file with a queried sequence ID or URL of a specified database.
When --get_gbk (-gg) is specified, --database (-db), --seqid (-si), and --output (-o) options are valid.
--protocol_description, -pd
Describe the 'Materials and Methods' of the DNA construct in a QUEEN-generated GenBank input.
When --protocol_description (-pd) is specified, --input (-i), and --output (-o) options are valid.
--script_description, -sd
Describe the python script to simulate the DNA construction process of a QUEEN-generated GenBank input.
When --script_description (-sd) is specified, --input (-i), and --output (-o) options are valid.
--feature_description, -fd
Print a table of the sequence features in a GenBank input.
When --feauture_description (-fd) is specified, --input (-i), --attribute (-a), --query(-q),
--columns (-c), --separation (-sep), --sequence (-seq), and --output (-o) options are valid.
--dnamap_visualization, -dv
Generate the annotated DNA sequence map in a GenBank input.
When --dnamap_visualization (-dv) is specified, --input (-i), --map_view (-m), --attribute (-a),
--query(-q), --sequence(-seq), --rcseq(-rs), --linebreak (-lb), and --output (-o) options are valid.
--protocolflow_visualization, -pv
Generate the flow chart representing the DNA construction processes of a QUEEN-generated GenBank input.
When --protocolflow_visualization (-pv) is specified, --input (-i) and --output (-o).
--cutdna, -cu
Cut the DNA construct of a given GenBank/Fasta input.
When --cutdna (-cu) is specified, --input (-i), --positions (-pos), and --output (-o) options are valid.
--cropdna, -cr
Extract a partial DNA fragment from a GenBank/Fasta input.
When --cropdna (-cr) is specified, --input (-i), --start (-s), --end (-e), and --output (-o) options are valid.
--flipdna, -fl
Generate the revese complement of a GenBank/Fasta input.
When --flipdna (-f) is specified, --input (-i) and --output (-o) options are valid.
--joindna, -jo
Join multiple GenBank inputs and generate the single assembled GenBank/Fasta output.
When --joindna (-j) is specified, --input (-i) and --output (-o) options are valid.
Argument options for QUEEN functions: Please use the appropriate argument options corresponding to the QUEEN function.
--database {ncbi,addgene,benchling}, -db {ncbi,addgene,benchling}
For '--db ncbi', set the NCBI accession number.
For '--db addgene', set plasmid ID. Sometimes different full sequence maps are provided by the depositor
and adgene, respectively, for a single plasmid. In this case, please specify the plasmid ID followed by
'addgene' or 'depositor' (Ex. 50005:addgene or 50005:depositor) If you set only plasmid ID, the value will
be specified as 'plsmidID:addgene'. For 'benchling', set a benchling shaared link.
--seqid SEQID, -si SEQID
Sequence ID for the corresponding database specified by '--database'.
--input INPUT [INPUT ...], -i INPUT [INPUT ...]
Input file with FASTA or GenBank format. The file type is estimated based on the file extension.
The value on stdin can also be used as a input.
--output OUTPUT, -o OUTPUT
--separation SEPARATION, -sep SEPARATION
String to separate values of each line. If the value is not given, space(s) to generate a well-formatted
table is used as separators. Output file. The file type is estimated based on the file extension.
If you specified "gbk" or "genbank" as this value. The genbank files holding the sequence regions of each
querid feature will be returned.
--positions POSITIONS [POSITIONS ...], -pos POSITIONS [POSITIONS ...]
List of cut positions. A cut position should be provided by `int`.
For generating sticy-ends, please use the QUEEN functions as python commands instead of this CLI.
--start START, -s START
Start position of the target range in the GenBank/Fasta input.
--end END, -e END
End position of the target range in the GenBank/Fasta input.
--attribute ATTRIBUTE [ATTRIBUTE ...], -a ATTRIBUTE [ATTRIBUTE ...]
Attribute type to be searched (feature_id, feature_type, 'qualifier:*', or sequence).
If the value is not provided, all sequence features will be to subjected to the operation by the specified command.
--query QUERY [QUERY ...], -q QUERY [QUERY ...]
Sequence features with the attribute values that match to the query will be searched.
--columns COLUMNS [COLUMNS ...], -c COLUMNS [COLUMNS ...]
List of feature attributes to be displayed in the output table.
If the value is 'all', it will generate a table for all the attributes held by the sequence features
in the GenBank input except for `sequence`.
--sequence, -seq
If True when --feature_description is specified, the sequence of each feature for its encoded direction will be
displayed in the output table. If True when --dnamap_visualization is specified, a color map representing
the QUEEN_object sequence will be displayed below the sequence map.
--rcseq, -rs
If True when --feature_description, the sequence of each feature for its encoded direction will be displayed in
the output table.
--linebreak LINEBREAK, -lb LINEBREAK
Sequence length for line break.
--map_view MAP_VIEW, -m MAP_VIEW
Visualization style. ('linear' or 'circular')
Please move to the demo/CLI directory and execute the following commands.
-
Download a GenBank file with a queried sequence ID or URL of a specified database.
By executing the following command, the GenBank file of pUC19 can be downloaded.
QUEEN --get_gbk --database addgene --seqid 50005 -
Describe the 'Materials and Methods' of the DNA construct in a QUEEN-generated GenBank input.
cat input/pCMV-Target-AID.gbk | QUEEN --protocol_description
The below command return the same result.
QUEEN --protocol_description --input input/pCMV-Target-AID.gbkOutput
1. The N-terminus half of Target-AID was amplified from pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(HPRT) using the primer pair RS045/HM129. 2. The C-terminus half of Target-AID was amplified from pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(HPRT) using the primer pair HM128/RS046. 3. A backbone fragment was amplified from pCMV-ABE7.10 using the primer pair RS047/RS048. 4. The three fragments were assembled by Gibson Assembly. -
Describe the python script to simulate the DNA construction process of a QUEEN-generated GenBank input.
QUEEN --script_description --input input/pCMV-Target-AID.gbkOutput
project='pCMV_Target_AID' import sys sys.path.append("/usr/local/lib/python3.9/site-packages") from QUEEN.queen import * from QUEEN import cutsite as cs pCMV_ABE = QUEEN(record='https://benchling.com/s/seq-K4HkSd2E8WiTAulJUeBf', dbtype='benchling', product='pCMV_ABE', process_id='pCMV_Target_AID-8VZ56URU5AVQ9VYZDJJUEMGH', original_ids=[], _sourcefile='pCMV_Target_AID_construction') pcDNA31_Target_AID = QUEEN(record='https://benchling.com/s/seq-cfnGDU0Mq8cUwn185LPF', dbtype='benchling', product='pcDNA31_Target_AID', process_id='pCMV_Target_AID-86JH1MQ2J28S2J1AKDNMTO9P', original_ids=[], _sourcefile='pCMV_Target_AID_construction') RS045 = QUEEN(seq='GAGAGCCGCCACCATGGCACCGAAGAAGAAGCG', supfeature={'feature_type': 'primer_bind', 'qualifier:label': 'RS045'}, product='RS045', process_id='pCMV_Target_AID-7OW3OF1RLWC5448Q9NCN80R9', original_ids=[], _sourcefile='pCMV_Target_AID_construction') HM129 = QUEEN(seq='CTGGGGCACGATATGATCCACGTCGTAGTCGGAGA', supfeature={'feature_type': 'primer_bind', 'qualifier:label': 'HM129'}, product='HM129', process_id='pCMV_Target_AID-1ARL2MY8QCUM1HKG1XKM984W', original_ids=[], _sourcefile='pCMV_Target_AID_construction') process1={'name':'PCR', 'description':'1. The N-terminus half of Target-AID was amplified from pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(HPRT) using the primer pair RS045/HM129.'} FW1 = pcDNA31_Target_AID.searchsequence(query=RS045.seq[-18:], product='FW1', process_name=process1['name'], process_description=process1['description'], process_id='pCMV_Target_AID-4NFVHEFMWRN16QPABJLD7ISH', original_ids=[], _sourcefile='pCMV_Target_AID_construction') RV1 = pcDNA31_Target_AID.searchsequence(query=HM129.seq[-18:], product='RV1', process_name=process1['name'], process_description=process1['description'], process_id='pCMV_Target_AID-5WVF01KPHJRH13M9YT8JSG3P', original_ids=[], _sourcefile='pCMV_Target_AID_construction') extract1 = cropdna(pcDNA31_Target_AID, start=FW1[0].end, end=RV1[0].start, product='extract1', process_name=process1['name'], process_description=process1['description'], process_id='pCMV_Target_AID-A8UBN1SA1NGJ6MRDO04MJN5D', original_ids=[], _sourcefile='pCMV_Target_AID_construction') fragment1 = modifyends(extract1, left=RS045.seq, right=HM129.rcseq, supfeature={'feature_id': 'f1', 'qualifier:label': 'fragment-1'}, product='fragment1', process_name=process1['name'], process_description=process1['description'], process_id='pCMV_Target_AID-1XSH4HNL9P3W5XDJJ26N8V6B', original_ids=[], _sourcefile='pCMV_Target_AID_construction') HM128 = QUEEN(seq='CTACGACGTGGATCATATCGTGCCCCAGTCTTTTC', supfeature={'feature_type': 'primer_bind', 'qualifier:label': 'HM128'}, product='HM128', process_id='pCMV_Target_AID-15MOJYKN6VG5B9AE07WDO4E9', original_ids=[], _sourcefile='pCMV_Target_AID_construction') RS046 = QUEEN(seq='TTTAAACTCATTATAGCATCTTGATCTTGTTCTCTC', supfeature={'feature_type': 'primer_bind', 'qualifier:label': 'RS046'}, product='RS046', process_id='pCMV_Target_AID-7ATW8VGEDIDK3TV6OLPAPNAO', original_ids=[], _sourcefile='pCMV_Target_AID_construction') process2={'name':'PCR', 'description':'2. The C-terminus half of Target-AID was amplified from pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(HPRT) using the primer pair HM128/RS046.'} FW2 = pcDNA31_Target_AID.searchsequence(query=HM128.seq[-18:], product='FW2', process_name=process2['name'], process_description=process2['description'], process_id='pCMV_Target_AID-7HC669JZUKZW7W9DQYU0EN74', original_ids=[], _sourcefile='pCMV_Target_AID_construction') RV2 = pcDNA31_Target_AID.searchsequence(query=RS046.seq[-18:], product='RV2', process_name=process2['name'], process_description=process2['description'], process_id='pCMV_Target_AID-AD3ESLVWRLTZB4HX3GY338EA', original_ids=[], _sourcefile='pCMV_Target_AID_construction') extract2 = cropdna(pcDNA31_Target_AID, start=FW2[0].end, end=RV2[0].start, product='extract2', process_name=process2['name'], process_description=process2['description'], process_id='pCMV_Target_AID-6K9AZGU8RT9QA2VDROZRK94F', original_ids=[], _sourcefile='pCMV_Target_AID_construction') fragment2 = modifyends(extract2, left=HM128.seq, right=RS046.rcseq, supfeature={'feature_id': 'f2', 'qualifier:label': 'fragment-2'}, product='fragment2', process_name=process2['name'], process_description=process2['description'], process_id='pCMV_Target_AID-BDKJOCPZRSFR6F268ZFB9X4E', original_ids=[], _sourcefile='pCMV_Target_AID_construction') RS047 = QUEEN(seq='ATCAAGATGCTATAATGAGTTTAAACCCGCTGATC', supfeature={'feature_type': 'primer_bind', 'qualifier:label': 'RS047'}, product='RS047', process_id='pCMV_Target_AID-ALZ0SU0JKMDZ42C7JGBVOPDV', original_ids=[], _sourcefile='pCMV_Target_AID_construction') RS048 = QUEEN(seq='CTTCGGTGCCATGGTGGCGGCTCTCCCTATAG', supfeature={'feature_type': 'primer_bind', 'qualifier:label': 'RS048'}, product='RS048', process_id='pCMV_Target_AID-2D0MSKUXK0M04Z2BVOWFLPQA', original_ids=[], _sourcefile='pCMV_Target_AID_construction') process3={'name':'PCR', 'description':'3. A backbone fragment was amplified from pCMV-ABE7.10 using the primer pair RS047/RS048.'} FW3 = pCMV_ABE.searchsequence(query=RS047.seq[-18:], product='FW3', process_name=process3['name'], process_description=process3['description'], process_id='pCMV_Target_AID-6Z7TJ8ZUETN4R8SGLIXCNHF4', original_ids=[], _sourcefile='pCMV_Target_AID_construction') RV3 = pCMV_ABE.searchsequence(query=RS048.seq[-18:], product='RV3', process_name=process3['name'], process_description=process3['description'], process_id='pCMV_Target_AID-WI28INSGUMCZ2NUOUFKKWIKE', original_ids=[], _sourcefile='pCMV_Target_AID_construction') extract3 = cropdna(pCMV_ABE, start=FW3[0].end, end=RV3[0].start, product='extract3', process_name=process3['name'], process_description=process3['description'], process_id='pCMV_Target_AID-36NO0BR31UOD3CM08BGT6WC7', original_ids=[], _sourcefile='pCMV_Target_AID_construction') fragment3 = modifyends(extract3, left=RS047.seq, right=RS048.rcseq, supfeature={'feature_id': 'f3', 'qualifier:label': 'fragment-3'}, product='fragment3', process_name=process3['name'], process_description=process3['description'], process_id='pCMV_Target_AID-98SJNGJWWQ3J8B8RAOU4YQF0', original_ids=[], _sourcefile='pCMV_Target_AID_construction') process4={'name':'Gibson Assembly', 'description':'4. The three fragments were assembled by Gibson Assembly.'} fragment1_mod = modifyends(fragment1, left='*{30}/-{30}', right='-{30}/*{30}', product='fragment1_mod', process_name=process4['name'], process_description=process4['description'], process_id='pCMV_Target_AID-6JNVDR69HUIVEYX7Z85NO11A', original_ids=[], _sourcefile='pCMV_Target_AID_construction') fragment2_mod = modifyends(fragment2, left='*{30}/-{30}', right='-{30}/*{30}', product='fragment2_mod', process_name=process4['name'], process_description=process4['description'], process_id='pCMV_Target_AID-AFMFFB673FWQBW3GA20LXBFH', original_ids=[], _sourcefile='pCMV_Target_AID_construction') fragment3_mod = modifyends(fragment3, left='*{30}/-{30}', right='-{30}/*{30}', product='fragment3_mod', process_name=process4['name'], process_description=process4['description'], process_id='pCMV_Target_AID-6867T0Q4KU2M9WCPFDME0HA1', original_ids=[], _sourcefile='pCMV_Target_AID_construction') pCMV_Target_AID = joindna(*[fragment1_mod, fragment2_mod, fragment3_mod], topology='circular', product='pCMV_Target_AID', process_name=process4['name'], process_description=process4['description'], process_id='pCMV_Target_AID-8IXV92W0BW934FILCZ1TOH7R', original_ids=[], _sourcefile='pCMV_Target_AID_construction') if __name__ == '__main__': pCMV_Target_AID.outputgbk() -
Describe the sequence features of the DNA construct in a QUEEN-generated GenBank input.
QUEEN --feature_description --input input/pCMV-Target-AID.gbkOutput
feature_id feature_type qualifier:label start end strand 0 source source 0 3308 + 100 primer_bind M13 Reverse 275 292 - 200 primer_bind M13/pUC Reverse 288 311 - 300 protein_bind lac operator 299 316 + 400 promoter lac promoter 323 354 - 500 protein_bind CAP binding site 368 390 + 600 primer_bind L4440 506 524 - 700 rep_origin ori 677 1266 - 800 primer_bind pBR322ori-F 757 777 - 900 CDS AmpR 1436 2297 - 1000 primer_bind Amp-R 2059 2079 + 1100 promoter AmpR promoter 2297 2402 - 1200 primer_bind pRS-marker 2480 2500 - 1300 enhancer CMV enhancer 2671 3051 + 1400 promoter CMV promoter 3051 3255 + 1500 primer_bind CMV-F 3205 3226 + 1600 promoter T7 promoter 3296 3315 + 1700 primer_bind RS048 3308 3340 - 1800 primer_bind RS045 3315 3348 + 1900 misc_feature fragment-1 3315 5911 + 2000 CDS SV40 NLS 3334 3355 + 2100 source source 3348 8678 + 2200 CDS Cas9(D10A) 3379 7483 + 2300 primer_bind HM129 5876 5911 - 2400 primer_bind HM128 5883 5918 + 2500 misc_feature fragment-2 5883 8714 + 2600 CDS SV40 NLS 7495 7516 + 2700 CDS 3xFLAG 7723 7789 + 2800 CDS PmCDA1 7795 8422 + 2900 CDS SV40 NLS 8422 8443 + 3000 CDS UGI 8449 8701 + 3100 primer_bind RS046 8678 8714 - 3200 primer_bind RS047 8689 8724 + 3300 misc_feature fragment-3 8689 3340 + 3400 source source 8724 8752 + 3500 primer_bind BGH-rev 8726 8744 - 3600 polyA_signal bGH poly(A) signal 8732 205 +By using --query and --attribute options, you can describe the seauence features holding a queried value in a designated attribute.
QUEEN --feature_description --input input/pCMV-Target-AID.gbk --query \.\*NLS --attribute qualifier:label --sequence --separation ,Output
feature_id,feature_type,qualifier:label,start,end,strand,sequence 2000,CDS,SV40 NLS,3334,3355,+,CCGAAGAAGAAGCGTAAAGTC 2600,CDS,SV40 NLS,7495,7516,+,CCCAAGAAGAAGAGGAAGGTG 2900,CDS,SV40 NLS,8422,8443,+,CCCAAGAAGAAAAGAAAAGTC -
Change the origin of a circular dna.
QUEEN --cutdna --input input/pCMV-Target-AID.gbk --positions 3379 | QUEEN --joindna > output/pCMV-Target-AID_slided.gbk
The output file isdemo/CLI/output/pCMV-Target-AID_slided.gbk. -
Extract the Cas9 fragment and generate its reverse complement.
QUEEN --cropdna --input input/pCMV-Target-AID.gbk --start 3379 --end 7483 | QUEEN --flipdna > output/Cas9_rc.gbk
The output file isdemo/CLI/output/Cas9_rc.gbk. -
Generate the annotated dna sequence map of the GenBank input.
QUEEN --dnamap_visualization --input input/pCMV-Target-AID.gbk --map_view circular --output output/pCMV-Target-AID_map.pdf
QUEEN --dnamap_visualization --input output/pCMV-Target-AID_slided.gbk --map_view circular --output output/pCMV-Target-AID_slided_map.pdf
QUEEN --dnamap_visualization --input output/Cas9_rc.gbk --linebreak 200 --sequence --rcseq --output output/Cas9_rc_map.pdf
The output files aredemo/CLI/output/pCMV-Target-AID_map.pdf,demo/CLI/output/pCMV-Target-AID_map_slided.pdf, anddemo/output/Cas9_rc_map.pdf. -
Generate the plotocol flow to construct a QUEEN-generated GenBank input.
QUEEN --protocolflow_visualization --input input/pCMV-Target-AID.gbk --output output/pCMV-Target-AID_flow.pdf"
The output file isdemo/CLI/output/pCMV-Target-AID_flow.pdf.