agat_sp_manage_IDs.pl and agat_sp_merge_annotations.pl throws out annotations

[sanyalab]

HI Jacques,

I have several gff3 files that look like below

##gff-version 3
##sequence-region Chr01 1 306748077
#!Date 2020-10-21
#!Type DNA
#!Source-version EMBOSS 6.6.0.0
Chr01 fuzznuc nucleotide_motif 13777291 13777318 28 - . ID=Chr01.1;note=*pat pattern:CGTGGGCGTGGGCGAGGCGGCGCGGAGT

I would like to concatenate these and change the "ID" to something else like "Chr01_MOTIF1", "Chr01_MOTIF2" and so on. I have tried both agat_sp_manage_IDs.pl and agat_sp_merge_annotations.pl, but they throw these annotations out, as child features are not provided. I do not have information to create the child features. How do I change the IDs using AGAT?

Thanks
Abhijit

[Juke34]

I could write a troubleshooting paragraph in the Readme.
As it is defined in the AGAT's feature json file nucleotide_motif feature must have a child otherwise it throws it away.
To modify this behaviour you should follow these steps:

agat_convert_sp_gxf2gxf.pl --expose

then modify the features_level1.json to replace "nucleotide_motif":"8", by "nucleotide_motif":"standalone",

then you can run agat_sp_manage_IDs.pl or agat_sp_merge_annotations.pl normally (the modified json file should be in the same place where you run the script).

[sanyalab]

Thank you Jacques. The issue is fixed with the modification you mentioned. Yes a troubleshooting readme will be nice. Best Regards Abhijit

…

On Thu, Oct 22, 2020 at 6:08 PM Jacques Dainat ***@***.***> wrote: I could write a troubleshooting paragraph in the Readme. As it is defined in the AGAT's feature json file nucleotide_motif must have a child otherwise it throw it away. To modify this behaviour you should follow this steps: agat_convert_sp_gxf2gxf.pl --expose then modify the features_level1.json to replace "nucleotide_motif":"8", by "nucleotide_motif":"standalone", then you can run agat_sp_manage_IDs.pl or agat_sp_merge_annotations.pl normally (the modified json file should be in the same place where you run the script). — You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub <#83 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AE545CPONVBTMWQC2VYMDGLSMARVFANCNFSM4S3BKBXQ> .