Skip to content
/ grepq Public

quickly filter fastq files by matching sequences to a set of regex patterns

License

Notifications You must be signed in to change notification settings

Rbfinch/grepq

Repository files navigation

Quickly filter FASTQ files

Crates.io License

Table of Contents

Feature set

  • very fast and scales to large FASTQ files
  • IUPAC ambiguity code support
  • support for gzip and zstd compression
  • JSON support for pattern file input and tune command output, allowing named regex sets and named regex patterns
  • use predicates to filter on the header field (= record ID line) using a regex, minimum sequence length, and minimum average quality score (supports Phred+33 and Phred+64)
  • does not match false positives
  • output matched sequences to one of four formats
  • tune your pattern file with the tune command
  • supports inverted matching with the inverted command
  • plays nicely with your unix workflows
  • comprehensive help, examples and testing script

Features and performance in detail

1. Very fast and scales to large FASTQ files

tool mean wall time (s) S.D. wall time (s) speedup (× grep) speedup (× ripgrep) speedup (× awk)
grepq 0.19 0.01 1796.76 18.62 863.52
fqgrep 0.34 0.01 1017.61 10.55 489.07
ripgrep 3.57 0.01 96.49 1.00 46.37
seqkit grep 2.89 0.01 119.33 1.24 57.35
grep 344.26 0.55 1.00 0.01 0.48
awk 165.45 1.59 2.08 0.02 1.00
gawk 287.66 1.68 1.20 0.01 0.58
Details

2022 model Mac Studio with 32GB RAM and Apple M1 max chip running macOS 15.0.1. The FASTQ file (SRX26365298.fastq) was 874MB in size and was stored on the internal SSD (APPLE SSD AP0512R). The pattern file contained 30 regex patterns (see `examples/16S-no-iupac.txt` for the patterns used). grepq v1.4.0, fqgrep v.1.02, ripgrep v14.1.1, seqkit grep v.2.9.0, grep 2.6.0-FreeBSD, awk v. 20200816, and gawk v.5.3.1. fqgrep and seqkit grep were run with default settings, ripgrep was run with -B 1 -A 2 --colors 'match:none' --no-line-number, and grep -B 1 -A 2 was run with --color=never. The tools were configured to output matching records in FASTQ format. The wall times, given in seconds, are the mean of 10 runs, and S.D. is the standard deviation of the wall times, also given in seconds.

2. Reads and writes regular or gzip or zstd-compressed FASTQ files

Use the --best option for best compression, or the --fast option for faster compression.

tool mean wall time (s) S.D. wall time (s) speedup (× ripgrep)
grepq 1.71 0.00 2.10
fqgrep 1.83 0.01 1.95
ripgrep 3.58 0.01 1.00
Details

Conditions and versions as above, but the FASTQ file was gzip-compressed. `grepq` was run with the `--read-gzip` option, `ripgrep` with the `-z` option, and `grep` with the `-Z` option. The wall times, given in seconds, are the mean of 10 runs, and S.D. is the standard deviation of the wall times, also given in seconds.

3. Predicates

Predicates can be used to filter on the header field (= record ID line) using a regex, minimum sequence length, and minimum average quality score (supports Phred+33 and Phred+64).

Note

A regex supplied to filter on the header field (= record ID line) is first passed as a string to the regex engine, and then the regex engine is used to match the header field. Regex patterns to match the header field (= record ID line) must comply with the Rust regex library syntax (https://docs.rs/regex/latest/regex/#syntax). If you get an error message, be sure to escape any special characters in the regex pattern.

Predicates are specified in a JSON pattern file. For an example, see 16S-iupac-and-predicates.json in the examples directory.

4. Does not match false positives

grepq will only match regex patterns to the sequence field of a FASTQ record, which is the most common use case. Unlike ripgrep and grep, which will match the regex patterns to the entire FASTQ record, which includes the record ID, sequence, separator, and quality fields. This can lead to false positives and slow down the filtering process.

5. Output matched sequences to one of four formats

  • sequences only (default)
  • sequences and their corresponding record IDs (-I option)
  • FASTA format (-F option)
  • FASTQ format (-R option)

Note

Other than when the tune command is run (see below), a FASTQ record is deemed to match (and hence provided in the output) when any of the regex patterns in the pattern file match the sequence field of the FASTQ record.

6. Will tune your pattern file with the tune command

Use the tune command (grepq tune -h for instructions) in a simple shell script to update the number and order of regex patterns in your pattern file according to their matched frequency, further targeting and speeding up the filtering process.

Specifying the -c option to the tune command will output the matched substrings and their frequencies, ranked from highest to lowest.

When the patterns file is given in JSON format, then specifying the -c, --names and --json-matches options to the tune command will output the matched substrings and their frequencies in JSON format to a file called matches.json, allowing named regex sets and named regex patterns. See examples/16S-iupac.json for an example of a JSON pattern file and examples/matches.json for an example of the output of the tune command in JSON format. Example (abridged) output:

{
  "regexSet": {
    "regex": [
      {
        "regexCount": 287,
        "regexName": "Primer contig 06a",
        "regexString": "[AG]AAT[AT]G[AG]CGGGG"
      },
      {
        "regexCount": 298,
        "regexName": "Primer contig 06aR",
        "regexString": "CCCCG[CT]C[AT]ATT[CT]"
      },
      {
        "regexCount": 1143,
        "regexName": "Primer contig 03",
        "regexString": "GG[AG][ACGT]GGC[ACGT]GCAG"
      }
    ],
    "regexSetName": "conserved 16S rRNA regions"
  }
}

Note

When the count option (-c) is given with the tune command, grepq will count the number of FASTQ records containing a sequence that is matched, for each matching regex in the pattern file. If, however, there are multiple occurrences of a given regex within a FASTQ record sequence field, grepq will count this as one match. When the count option (-c) is not given with the tune command, grepq provides the total number of matching FASTQ records for the set of regex patterns in the pattern file.

7. Supports inverted matching with the inverted command

Use the inverted command to output sequences that do not match any of the regex patterns in your pattern file.

8. Plays nicely with your unix workflows

For example, see tune.sh in the examples directory. This simple script will filter a FASTQ file using grepq, tune the pattern file on a user-specified number of FASTQ records, and then filter the FASTQ file again using the tuned pattern file for a user-specified number of the most frequent regex pattern matches.

Usage

Get instructions and examples using grepq -h, and grepq tune -h and grepq inverted -h for more information on the tune and inverted commands, respectively.

Note

grepq can output to several formats, including those that are gzip or zstd compressed. grepq, however, will only accept a FASTQ file or a compressed (gzip or zstd) FASTQ file as the sequence data file. If you get an error message, check that the input data file is a FASTQ file or a gzip or zstd compressed FASTQ file, and that you have specified the correct file format (--read-gzip or --read-zstd for FASTQ files compressed by gzip and zstd, respectively), and file path. Pattern files must contain one regex pattern per line or be provided in JSON format, and patterns are case-sensitive. You can supply an empty pattern file to count the total number of records in the FASTQ file. The regex patterns for matching FASTQ sequences should only include the DNA sequence characters (A, C, G, T), or IUPAC ambiguity codes (N, R, Y, etc.). See 16S-no-iupac.txt, 16S-iupac.json and 16S-iupac-and-predicates.json in the examples directory for examples of valid pattern files. Regex patterns to match the header field (= record ID line) must comply with the Rust regex library syntax (https://docs.rs/regex/latest/regex/#syntax). If you get an error message, be sure to escape any special characters in the regex pattern.

Requirements

  • grepq has been tested on Linux and macOS. It might work on Windows WSL, but it has not been tested.
  • Ensure that Rust is installed on your system (https://www.rust-lang.org/tools/install)
  • If the build fails, make sure you have the latest version of the Rust compiler by running rustup update
  • To run the test.sh and cookbook.sh scripts in the examples directory, you will need yq (v4.44.6 or later), gunzip and version 4 or later of bash.

Installation

  • From crates.io (easiest method, but will not install the examples directory)

    • cargo install grepq
  • From source (will install the examples directory)

    • Clone the repository and cd into the grepq directory
    • Run cargo build --release
    • Relative to the cloned parent directory, the executable will be located in ./target/release
    • Make sure the executable is in your PATH or use the full path to the executable

Examples and tests

Get instructions and examples using grepq -h, grepq tune -h and grepq inverted -h for more information on the tune and inverted commands, respectively. See the examples directory for examples of pattern files and FASTQ files.

File sizes of outfiles to verify grepq is working correctly, using the regex file 16S-no-iupac.txt and the small fastq file small.fastq, both located in the examples directory:

grepq ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt 
15953

grepq  ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt
736547

grepq -I ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt
19515

grepq -I ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt 
901271

grepq -R ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt
35574

grepq -R ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt 
1642712

For the curious-minded, note that the regex patterns in 16S-no-iupac.txt, 16S-iupac.json, and 16S-iupac-and-predicates.json are from Table 3 of Martinez-Porchas, Marcel, et al. "How conserved are the conserved 16S-rRNA regions?." PeerJ 5 (2017): e3036.

For more examples, see the examples directory and the cookbook, available also as a shell script in the examples directory.

Test script

You may also run the test script (test.sh) in the examples directory to more fully test grepq. From the examples directory, run the following command:

./test.sh commands-1.yaml; ./test.sh commands-2.yaml; ./test.sh commands-3.yaml; ./test.sh commands-4.yaml

If all tests pass, there will be no orange (warning) text in the output, and no test will report a failure. A summary of the number of passing and failing tests will be displayed at the end of the output. All tests should pass.

Example of failing test output:

test-7 failed
expected: 54 counts
got: 53 counts
command was: ../target/release/grepq -c 16S-no-iupac.txt small.fastq

Further, you can run the cookbook.sh script in the examples directory to test the cookbook examples, and you can use predate (https://crates.io/crates/predate) if you prefer a Rust application to a shell script.

SARS-CoV-2 example

Count of the top five most frequently matched patterns found in SRX26602697.fastq using the pattern file SARS-CoV-2.txt (this pattern file contains 64 sequences of length 60 from Table II of this preprint):

time grepq SARS-CoV-2.txt SRX26602697.fastq tune -n 10000 -c | head -5
GTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGT: 1595
CGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGA: 693
TCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAA: 356
GCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCT: 332
CCGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTAT: 209

________________________________________________________
Executed in  218.80 millis    fish           external
   usr time  188.97 millis    0.09 millis  188.88 millis
   sys time   31.47 millis    4.98 millis   26.49 millis

Obtain SRX26602697.fastq from the SRA using fastq-dump --accession SRX26602697.

Further testing

grepq can be tested using tools that generate synthetic FASTQ files, such as spikeq (https://crates.io/crates/spikeq)

You can verify that grepq has found the regex patterns by using tools such as grep and ripgrep, using their ability to color-match the regex patterns (this feature is not available in grepq as that would make the code more complicated; code maintainability is an objective of this project). Recall, however, that grep and ripgrep will match the regex patterns to the entire FASTQ record, which includes the record ID, sequence, separator, and quality fields, occasionally leading to false positives.

Citation

If you use grepq in your research, please cite as follows:

Crosbie, N.D. (2024). grepq: A Rust application that quickly filters FASTQ files by matching sequences to a set of regex patterns. 10.5281/zenodo.14031703

Update changes

see CHANGELOG

License

MIT