fix err messages, add basic example

bwt/bitvector.go

@@ -1,6 +1,7 @@
 package bwt
 
 import (
+	"fmt"
 	"math"
 )
 
@@ -62,7 +63,8 @@ func (b bitvector) setBit(i int, val bool) {
 
 func (b bitvector) checkBounds(i int) {
 	if i >= b.len() || i < 0 {
-		panic("better out of bounds message")
+		msg := fmt.Sprintf("access of %d is out of bounds for bitvector with length %d", i, b.len())
+		panic(msg)
 	}
 }
 

bwt/bwt.go

@@ -333,7 +333,8 @@ func (bwt BWT) lookupSkipByOffset(offset int) skipEntry {
 			return bwt.firstColumnSkipList[skipIndex]
 		}
 	}
-	panic("figure out what to do here")
+	msg := fmt.Sprintf("could not find the skip entry that falls within the range of the skip column at a given offset. range: [0, %d) offset: %d", bwt.getLenOfOriginalStringWithNullChar(), offset)
+	panic(msg)
 }
 
 func (bwt BWT) getLenOfOriginalStringWithNullChar() int {

bwt/example_test.go

@@ -8,6 +8,28 @@ import (
 	"golang.org/x/exp/slices"
 )
 
+// This example shows how BWT can be used for exact pattern
+// matching by returning the offsets at which the pattern exists.
+// This can be useful for alignment when you need  need to reduce
+// the memory footprint of a reference sequence without loosing
+// any data since BWT is a lossless compression.
+func ExampleBWT_basic() {
+	inputSequence := "AACCTGCCGTCGGGGCTGCCCGTCGCGGGACGTCGAAACGTGGGGCGAAACGTG"
+
+	bwt, err := bwt.New(inputSequence)
+	if err != nil {
+		log.Fatal(err)
+	}
+
+	offsets, err := bwt.Locate("GCC")
+	if err != nil {
+		log.Fatal(err)
+	}
+	slices.Sort(offsets)
+	fmt.Println(offsets)
+	// Output: [5 17]
+}
+
 func ExampleBWT_Count() {
 	inputSequence := "AACCTGCCGTCGGGGCTGCCCGTCGCGGGACGTCGAAACGTGGGGCGAAACGTG"