-
Notifications
You must be signed in to change notification settings - Fork 104
[sambamba view] documentation
sambamba-view
- tool for extracting information from SAM/BAM/CRAM files
sambamba-view
[OPTIONS] <input.bam | input.sam> [region1 [...]]
sambamba-view
allows to efficiently view and filter BAM file for alignments
satisfying various conditions, as well as access its SAM header and
information about reference sequences. In order to make these data
readily available for consumption by scripts in Perl/Python/Ruby,
JSON output is provided.
By default, the tool expects BAM file as an input.
In order to work with SAM file, specify -S
|--sam-input
command-line
option, the tool does NOT try to guess file format from extension.
Beware that when reading SAM, the tool will skip tags which don't conform
to the SAM/BAM specification, and set invalid fields to their default values.
However, only syntax is checked, use --valid
for full validation.
CRAM functionality has been added recently. For more information on VIEW, see also the original samtools documentation.
Filtering is presented in two ways. First, you can specify a condition
with -F
option, using a special language for filtering, described
here
Second, if you have an indexed BAM file, several regions can be specified as well. The syntax for regions is the same as in samtools: chr:beg-end where beg and end are 1-based start and end of a closed-end interval on the reference chr.
Alignment record JSON representation is a hash with keys 'qname', 'flag', 'rname', 'pos', 'mapq', 'cigar', 'rnext', 'qual', 'tags', e.g.
{"qname":"EAS56_57:6:190:289:82","flag":69,"rname":"chr1","pos":100,
"mapq":0,"cigar":"*","rnext":"=","pnext":100,"tlen":0,
"seq":"CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA",
"qual":[27,27,27,22,27,27,27,26,27,27,27,27,27,27,27,27,23,26,26,27,
22,26,19,27,26,27,26,26,26,26,26,24,19,27,26],"tags":{"MF":192}}
This format may change in the future versions for performance reasons.
-
-F
,--filter
=FILTER: -
Set custom filter for alignments.
-
-f
,--format
=FORMAT: -
Specify output format. <FORMAT> must be one of sam, bam, or json (in lowercase). Default one is SAM.
-
-h
,--with-header
: -
Print SAM header before reads. This is always done for BAM output.
-
-H
,--header
: -
Print only SAM header to STDOUT. If <FORMAT> is sam or bam, its text version is printed, otherwise JSON object is written.
-
-I
,--reference-info
: -
Output to STDOUT reference sequence names and lengths in JSON (see [EXAMPLES][]).
-
-c
,--count
: -
Output to STDOUT only the number of matching records, -hHI options are ignored.
-
-v
,--valid
: -
Output only valid reads.
-
-S
,--sam-input
: -
Specify that the input is SAM file (default is BAM for all operations).
-
-p
,--show-progress
: -
Show progressbar in STDERR. Works only for BAM files, and with no regions specified, i.e. only when reading full file.
-
-l
,--compression-level
=COMPRESSION_LEVEL: -
Set compression level for BAM output, a number from 0 to 9.
-
-o
,--output-filename
=FILENAME: -
Specify output filename (by default everything is written to STDOUT).
Print basic reference sequence information:
$ sambamba-view --reference-info ex1_header.bam
[{"name":"chr1","length":1575},{"name":"chr2","length":1584}]
Count reads with mapping quality not less than 50:
$ sambamba-view -c -F "mapping_quality >= 50" ex1_header.bam
3124
Count properly paired reads overlapping 100..200 on chr1:
$ sambamba-view -c -F "proper_pair" ex1_header.bam chr1:100-200
39
Output header in JSON format:
$ sambamba-view --header --format=json ex1_header.bam
{"format_version":"1.3","rg_lines":[],
"sq_lines":[{"sequence_length":1575,"species":"","uri":"",
"sequence_name":"chr1","assembly":"","md5":""},
{"sequence_length":1584,"species":"","uri":"",
"sequence_name":"chr2","assembly":"","md5":""}],
"sorting_order":"coordinate","pg_lines":[]}
There's no way to see validation error messages or to set validation stringency at the moment.