[sambamba view] documentation

NAME

sambamba-view - tool for extracting information from SAM/BAM/CRAM files

SYNOPSIS

sambamba-view [OPTIONS] <input.bam | input.sam> [region1 [...]]

DESCRIPTION

sambamba-view allows to efficiently view and filter BAM file for alignments satisfying various conditions, as well as access its SAM header and information about reference sequences. In order to make these data readily available for consumption by scripts in Perl/Python/Ruby, JSON output is provided.

By default, the tool expects BAM file as an input. In order to work with SAM file, specify -S|--sam-input command-line option, the tool does NOT try to guess file format from extension. Beware that when reading SAM, the tool will skip tags which don't conform to the SAM/BAM specification, and set invalid fields to their default values. However, only syntax is checked, use --valid for full validation.

CRAM functionality has been added recently. For more information on VIEW, see also the original samtools documentation.

FILTERING

Filtering is presented in two ways. First, you can specify a condition with -F option, using a special language for filtering, described here

Second, if you have an indexed BAM file, several regions can be specified as well. The syntax for regions is the same as in samtools: chr:beg-end where beg and end are 1-based start and end of a closed-end interval on the reference chr.

JSON

Alignment record JSON representation is a hash with keys 'qname', 'flag', 'rname', 'pos', 'mapq', 'cigar', 'rnext', 'qual', 'tags', e.g.

{"qname":"EAS56_57:6:190:289:82","flag":69,"rname":"chr1","pos":100,
"mapq":0,"cigar":"*","rnext":"=","pnext":100,"tlen":0,
"seq":"CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA",
"qual":[27,27,27,22,27,27,27,26,27,27,27,27,27,27,27,27,23,26,26,27,
22,26,19,27,26,27,26,26,26,26,26,24,19,27,26],"tags":{"MF":192}}

This format may change in the future versions for performance reasons.

OPTIONS

-F, --filter=FILTER:

Set custom filter for alignments.

-f, --format=FORMAT:

Specify output format. <FORMAT> must be one of sam, bam, or json (in lowercase).
Default one is SAM.

-h, --with-header:

Print SAM header before reads. This is always done for BAM output.

-H, --header:

Print only SAM header to STDOUT. If <FORMAT> is sam or bam, its text version is
printed, otherwise JSON object is written.

-I, --reference-info:

Output to STDOUT reference sequence names and lengths in JSON (see [EXAMPLES][]).

-c, --count:

Output to STDOUT only the number of matching records, -hHI options are ignored.

-v, --valid:

Output only valid reads.

-S, --sam-input:

Specify that the input is SAM file (default is BAM for all operations).

-p, --show-progress:

Show progressbar in STDERR. Works only for BAM files, and with no regions
specified, i.e. only when reading full file.

-l, --compression-level=COMPRESSION_LEVEL:

Set compression level for BAM output, a number from 0 to 9.

-o, --output-filename=FILENAME:

Specify output filename (by default everything is written to STDOUT).

EXAMPLES

Print basic reference sequence information:

 $ sambamba-view --reference-info ex1_header.bam
 [{"name":"chr1","length":1575},{"name":"chr2","length":1584}]

Count reads with mapping quality not less than 50:

 $ sambamba-view -c -F "mapping_quality >= 50" ex1_header.bam
 3124

Count properly paired reads overlapping 100..200 on chr1:

 $ sambamba-view -c -F "proper_pair" ex1_header.bam chr1:100-200
 39

Output header in JSON format:

 $ sambamba-view --header --format=json ex1_header.bam
 {"format_version":"1.3","rg_lines":[],  
  "sq_lines":[{"sequence_length":1575,"species":"","uri":"",  
  "sequence_name":"chr1","assembly":"","md5":""},  
  {"sequence_length":1584,"species":"","uri":"",  
  "sequence_name":"chr2","assembly":"","md5":""}],  
  "sorting_order":"coordinate","pg_lines":[]}

BUGS

There's no way to see validation error messages or to set validation stringency at the moment.