Merge pull request #364 from nf-core/move-protocols-to-profiles

Move protocols to config profile(s)
nf-core · Jul 31, 2024 · 374ec02 · 374ec02
2 parents 7e503f8 + d908088
commit 374ec02
Show file tree

Hide file tree

Showing 18 changed files with 60 additions and 70 deletions.
diff --git a/.github/workflows/awstest.yml b/.github/workflows/awstest.yml
@@ -23,7 +23,7 @@ jobs:
             {
               "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/smrnaseq/results-test-${{ github.sha }}"
             }
-          profiles: test
+          profiles: test,illumina
 
       - uses: actions/upload-artifact@v4
         with:

diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml
@@ -27,10 +27,10 @@ jobs:
           - "23.04.0"
           - "latest-everything"
         profile:
-          - "test"
-          - "test_no_genome"
-          - "test_umi"
-          - "test_index"
+          - "test,illumina"
+          - "test_no_genome,illumina"
+          - "test_umi,illumina"
+          - "test_index,illumina"
     steps:
       - name: Check out pipeline code
         uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4

diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml
@@ -76,7 +76,7 @@ jobs:
         env:
           NXF_SINGULARITY_CACHEDIR: ./
           NXF_SINGULARITY_HOME_MOUNT: true
-        run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results
+        run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -stub -profile test,singularity,illumina --outdir ./results
       - name: Run the downloaded pipeline (stub run not supported)
         id: run_pipeline
         if: ${{ job.steps.stub_run_pipeline.status == failure() }}

diff --git a/CHANGELOG.md b/CHANGELOG.md
@@ -3,11 +3,12 @@
 The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/)
 and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html).
 
-## v2.3.2dev - 2024-XX-XX - X
+## v2.4.0dev - 2024-XX-XX - X
 
 - [[#332]](https://github.com/nf-core/smrnaseq/issues/332) by [[#361]](https://github.com/nf-core/smrnaseq/pull/361) - Fix documentation to use only single-end
 - [[#349]](https://github.com/nf-core/smrnaseq/pull/349) - Fix [MIRTOP_QUANT conda issue](https://github.com/nf-core/smrnaseq/issues/347), change conda-base to conda-forge channel
 - [[#350]](https://github.com/nf-core/smrnaseq/pull/350) - Fix [MIRTOP_QUANT conda issue](https://github.com/nf-core/smrnaseq/issues/347), set python version to 3.7 to fix pysam issue
+- [[#351]](https://github.com/nf-core/smrnaseq/issues/351) - Fix [Protocol inheritance issue](https://github.com/nf-core/smrnaseq/pull/364) - fixing protocol inheritance from subworkflow with move to config profile(s) for different protocols
 
 ## v2.3.1 - 2024-04-18 - Gray Zinc Dalmation Patch
 

diff --git a/README.md b/README.md
@@ -100,11 +100,10 @@ Now, you can run the pipeline using:
 
 ```bash
 nextflow run nf-core/smrnaseq \
-   -profile <docker/singularity/.../institute> \
+   -profile <docker/singularity/.../institute>,illumina \
   --input samplesheet.csv \
   --genome 'GRCh37' \
   --mirtrace_species 'hsa' \
-  --protocol 'illumina' \
   --outdir <OUTDIR>
 ```
 

diff --git a/conf/protocol_cats.config b/conf/protocol_cats.config
@@ -0,0 +1,7 @@
+//This profile handles CATs miRNA defaults. Include it as an additional profile to set certain pipeline parameters appropriately.
+params{
+    clip_r1 = 3
+    three_prime_clip_r1 = 0
+    three_prime_adapter = "AAAAAAAA"
+    protocol = 'cats'
+}
diff --git a/conf/protocol_illumina.config b/conf/protocol_illumina.config
@@ -0,0 +1,7 @@
+//This profile handles Illumina miRNA defaults. Include it as an additional profile to set certain pipeline parameters appropriately.
+params{
+    clip_r1 = 0
+    three_prime_clip_r1 = 0
+    three_prime_adapter = "TGGAATTCTCGGGTGCCAAGG"
+    protocol = 'illumina'
+}
diff --git a/conf/protocol_nextflex.config b/conf/protocol_nextflex.config
@@ -0,0 +1,7 @@
+//This profile handles Nextflex miRNA defaults. Include it as an additional profile to set certain pipeline parameters appropriately.
+params{
+    clip_r1 = 4
+    three_prime_clip_r1 = 4
+    three_prime_adapter = "TGGAATTCTCGGGTGCCAAGG"
+    protocol = 'nextflex'
+}
diff --git a/conf/protocol_qiaseq.config b/conf/protocol_qiaseq.config
@@ -0,0 +1,7 @@
+//This profile handles QIASEQ miRNA defaults. Include it as an additional profile to set certain pipeline parameters appropriately.
+params{
+    clip_r1 = 0
+    three_prime_clip_r1 = 0
+    three_prime_adapter = "AACTGTAGGCACCATCAAT"
+    protocol = 'qiaseq'
+}
diff --git a/conf/test.config b/conf/test.config
@@ -25,7 +25,6 @@ params {
     fasta            = 'https://github.com/nf-core/test-datasets/raw/smrnaseq/reference/genome.fa'
 
     mirtrace_species         = 'hsa'
-    protocol                 = 'illumina'
     skip_mirdeep             = true
     save_merged              = false
     save_aligned_mirna_quant = false

diff --git a/conf/test_full.config b/conf/test_full.config
@@ -18,7 +18,6 @@ params {
     input            = 'https://github.com/nf-core/test-datasets/raw/smrnaseq/samplesheet/v2.0/samplesheet-full.csv'
     genome           = 'GRCh37'
     mirtrace_species = 'hsa'
-    protocol         = 'illumina'
 }
 
 
diff --git a/conf/test_index.config b/conf/test_index.config
@@ -26,7 +26,6 @@ params {
     bowtie_index     = 'https://github.com/nf-core/test-datasets/raw/smrnaseq/reference/bowtie_index.tar.gz'
 
     mirtrace_species         = 'hsa'
-    protocol                 = 'illumina'
     skip_mirdeep             = true
     save_merged              = false
     save_aligned_mirna_quant = false

diff --git a/conf/test_no_genome.config b/conf/test_no_genome.config
@@ -26,6 +26,5 @@ params {
     mirna_gtf        = 'https://github.com/nf-core/test-datasets/raw/smrnaseq/reference/hsa.gff3'
     mirtrace_species = 'hsa'
     skip_mirdeep     = true
-    protocol         = 'illumina'
 
 }
diff --git a/conf/test_umi.config b/conf/test_umi.config
@@ -25,7 +25,6 @@ params {
     fasta            = 'https://github.com/nf-core/test-datasets/raw/smrnaseq/reference/genome.fa'
 
     mirtrace_species = 'hsa'
-    protocol         = 'illumina'
     skip_mirdeep     = true
 
     //UMI Specific testcase

diff --git a/docs/usage.md b/docs/usage.md
@@ -14,11 +14,18 @@ This option indicates the experimental protocol used for the sample preparation.
 - 'nextflex': adapter (`TGGAATTCTCGGGTGCCAAGG`), clip_r1 (`4`), three_prime_clip_r1 (`4`)
 - 'qiaseq': adapter (`AACTGTAGGCACCATCAAT`)
 - 'cats': adapter (`GATCGGAAGAGCACACGTCTG`), clip_r1(`3)
-- 'custom' (where the user can indicate the `three_prime_adapter`, `clip_r1` and `three_prime_clip_r1` manually)
+
+This option is not chosen as a parameter but as an additional profile that sets the corresponding `three_prime_adapter`, `clip_r1` and `three_prime_clip_r1` parameters accordingly. You can choose to either use any of the provided profiles by running the pipeline with e.g. `illumina` to set the defaults as described above in a more convenient way.
+
+```bash
+-profile your_other_profiles,illumina
+```
+
+In case you have a custom protocol, please supply the `three_prime_adapter`, `clip_r1` and `three_prime_clip_r1` manually.
 
 The parameter `--three_prime_adapter` is set to the Illumina TruSeq single index adapter sequence `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`. This is also to ensure, that the auto-detect functionality of `FASTP` is disabled. Please make sure to adapt this adapter sequence accordingly for your run.
 
-:warning: At least the `custom` protocol has to be specified, otherwise the pipeline won't run. In case you specify the `custom` protocol, ensure that the parameters above are set accordingly or the defaults will be applied. If you want to auto-detect the adapters using `fastp`, please set `--three_prime_adapter` to `auto-detect`.
+:warning: If you do not choose a profile that sets the `three_prime_adapter`, `clip_r1` and `three_prime_clip_r1` options, the pipeline won't run. If you want to auto-detect the adapters using `fastp`, please set `--three_prime_adapter` to `auto-detect`.
 
 ### `mirtrace_species` or `mirgenedb_species`
 

diff --git a/nextflow.config b/nextflow.config
@@ -13,8 +13,8 @@ params {
 
     input                       = null
 
-    // Workflow flags
-    protocol                    = 'illumina'
+    // Protocol default (override via config profile - NOT directly via parameter!)
+    protocol                    = "Custom"
 
     // References
     genome                      = null
@@ -243,6 +243,12 @@ profiles {
     test_no_genome { includeConfig 'conf/test_no_genome.config' }
     test_full      { includeConfig 'conf/test_full.config' }
     test_index     { includeConfig 'conf/test_index.config' }
+
+    //Protocol specific profiles
+    cats           { includeConfig 'conf/protocol_cats.config' }
+    illumina       { includeConfig 'conf/protocol_illumina.config' }
+    qiaseq         { includeConfig 'conf/protocol_qiaseq.config' }
+    nextflex       { includeConfig 'conf/protocol_nextflex.config' }
 }
 
 // Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile

diff --git a/nextflow_schema.json b/nextflow_schema.json
@@ -23,14 +23,6 @@
                     "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/smrnaseq/usage#samplesheet-input).",
                     "fa_icon": "fas fa-file-csv"
                 },
-                "protocol": {
-                    "type": "string",
-                    "default": "illumina",
-                    "fa_icon": "fas fa-vial",
-                    "description": "Protocol for constructing smRNA-seq libraries.",
-                    "help_text": "Presets for trimming parameters and 3' adapter sequence with a specified protocol.\n\n| Protocol      | Library Prep Kit                        | Trimming Parameter                      | 3' Adapter Sequence     |\n| :------------ | :-------------------------------------- | :-------------------------------------- | :---------------------  |\n| illumina      | Illumina TruSeq Small RNA               | `clip_r1 = 0` `three_prime_clip_r1 = 0` | `TGGAATTCTCGGGTGCCAAGG` |\n| nextflex      | BIOO SCIENTIFIC  NEXTFLEX Small RNA-Seq | `clip_r1 = 4` `three_prime_clip_r1 = 4` | `TGGAATTCTCGGGTGCCAAGG` |\n| qiaseq        | QIAGEN QIAseq miRNA                     | `clip_r1 = 0` `three_prime_clip_r1 = 0` | `AACTGTAGGCACCATCAAT`   |\n| cats          | Diagenode CATS Small RNA-seq            | `clip_r1 = 3` `three_prime_clip_r1 = 0` | `AAAAAAAAAAA` + `GATCGGAAGAGCACACGTCTG` (only polyA is used for trimming) |\n| custom        | user defined                            | user defined                            | user defined            |\n\n> NB: When running `--protocol custom` the user ***must define the 3' Adapter Sequence***.\n> If trimming parameters aren't provided the pipeline will deafult to `clip_R1 = 0` and `three_prime_clip_R1 = 0` (i.e. no extra clipping).",
-                    "enum": ["illumina", "nextflex", "qiaseq", "cats", "custom"]
-                },
                 "outdir": {
                     "type": "string",
                     "format": "directory-path",
@@ -48,6 +40,11 @@
                     "type": "string",
                     "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
                     "fa_icon": "fas fa-file-signature"
+                },
+                "protocol": {
+                    "type": "string",
+                    "default": "Custom",
+                    "fa_icon": "fas fa-atom"
                 }
             }
         },

diff --git a/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_smrnaseq_pipeline/main.nf
@@ -50,8 +50,7 @@ workflow PIPELINE_INITIALISATION {
         outdir,
         workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1
     )
-    //Detect Protocol setting, set this early before help so help shows proper adapters etc pp
-    formatProtocol(params,log)
+
     //
     // Validate parameters and generate parameter summary to stdout
     //
@@ -261,45 +260,3 @@ def methodsDescriptionText(mqc_methods_yaml) {
 
     return description_html.toString()
 }
-
-/*
-* Format the protocol
-* Given the protocol parameter (params.protocol),
-* this function formats the protocol such that it is fit for the respective
-* subworkflow
-*/
-def formatProtocol(params,log) {
-
-    switch(params.protocol){
-        case 'illumina':
-            params.putIfAbsent("clip_r1", 0);
-            params.putIfAbsent("three_prime_clip_r1",0);
-            params.putIfAbsent("three_prime_adapter", "TGGAATTCTCGGGTGCCAAGG");
-            break
-        case 'nextflex':
-            params.putIfAbsent("clip_r1", 4);
-            params.putIfAbsent("three_prime_clip_r1", 4);
-            params.putIfAbsent("three_prime_adapter", "TGGAATTCTCGGGTGCCAAGG");
-            break
-        case 'qiaseq':
-            params.putIfAbsent("clip_r1",0);
-            params.putIfAbsent("three_prime_clip_r1",0);
-            params.putIfAbsent("three_prime_adapter","AACTGTAGGCACCATCAAT");
-            break
-        case 'cats':
-            params.putIfAbsent("clip_r1",3);
-            params.putIfAbsent("three_prime_clip_r1", 0);
-            params.putIfAbsent("three_prime_adapter", "AAAAAAAA");
-            break
-        case 'custom':
-            params.putIfAbsent("clip_r1", params.clip_r1)
-            params.putIfAbsent("three_prime_clip_r1", params.three_prime_clip_r1)
-        default:
-            log.warn "Please make sure to specify all required clipping and trimming parameters, otherwise only adapter detection will be performed."
-        }
-
-        log.warn "Running with Protocol ${params.protocol}"
-        log.warn "Therefore using Adapter: ${params.three_prime_adapter}"
-        log.warn "Clipping ${params.clip_r1} bases from R1"
-        log.warn "And clipping ${params.three_prime_clip_r1} bases from 3' end"
-    }