Merge pull request #344 from nf-core/dev

Release 2.3.1 PR

.devcontainer/devcontainer.json

@@ -10,15 +10,7 @@
         "vscode": {
             // Set *default* container specific settings.json values on container create.
             "settings": {
-                "python.defaultInterpreterPath": "/opt/conda/bin/python",
-                "python.linting.enabled": true,
-                "python.linting.pylintEnabled": true,
-                "python.formatting.autopep8Path": "/opt/conda/bin/autopep8",
-                "python.formatting.yapfPath": "/opt/conda/bin/yapf",
-                "python.linting.flake8Path": "/opt/conda/bin/flake8",
-                "python.linting.pycodestylePath": "/opt/conda/bin/pycodestyle",
-                "python.linting.pydocstylePath": "/opt/conda/bin/pydocstyle",
-                "python.linting.pylintPath": "/opt/conda/bin/pylint"
+                "python.defaultInterpreterPath": "/opt/conda/bin/python"
             },
 
             // Add the IDs of extensions you want installed when the container is created.

.github/CONTRIBUTING.md

@@ -9,9 +9,8 @@ Please use the pre-filled template to save time.
 However, don't be put off by this template - other more general issues and suggestions are welcome!
 Contributions to the code are even more welcome ;)
 
-:::info
-If you need help using or modifying nf-core/smrnaseq then the best place to ask is on the nf-core Slack [#smrnaseq](https://nfcore.slack.com/channels/smrnaseq) channel ([join our Slack here](https://nf-co.re/join/slack)).
-:::
+> [!NOTE]
+> If you need help using or modifying nf-core/smrnaseq then the best place to ask is on the nf-core Slack [#smrnaseq](https://nfcore.slack.com/channels/smrnaseq) channel ([join our Slack here](https://nf-co.re/join/slack)).
 
 ## Contribution workflow
 
@@ -27,8 +26,11 @@ If you're not used to this workflow with git, you can start with some [docs from
 
 ## Tests
 
-You can optionally test your changes by running the pipeline locally. Then it is recommended to use the `debug` profile to
-receive warnings about process selectors and other debug info. Example: `nextflow run . -profile debug,test,docker --outdir <OUTDIR>`.
+You have the option to test your changes locally by running the pipeline. For receiving warnings about process selectors and other `debug` information, it is recommended to use the debug profile. Execute all the tests with the following command:
+
+```bash
+nf-test test --profile debug,test,docker --verbose
+```
 
 When you create a pull request with changes, [GitHub Actions](https://github.com/features/actions) will run automatic tests.
 Typically, pull-requests are only fully reviewed when these tests are passing, though of course we can help out before then.
@@ -90,7 +92,7 @@ Once there, use `nf-core schema build` to add to `nextflow_schema.json`.
 
 Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/master/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels.
 
-The process resources can be passed on to the tool dynamically within the process with the `${task.cpu}` and `${task.memory}` variables in the `script:` block.
+The process resources can be passed on to the tool dynamically within the process with the `${task.cpus}` and `${task.memory}` variables in the `script:` block.
 
 ### Naming schemes
 

.github/PULL_REQUEST_TEMPLATE.md

@@ -18,7 +18,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/smrn
 - [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/smrnaseq/tree/master/.github/CONTRIBUTING.md)
 - [ ] If necessary, also make a PR on the nf-core/smrnaseq _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository.
 - [ ] Make sure your code lints (`nf-core lint`).
-- [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir <OUTDIR>`).
+- [ ] Ensure the test suite passes (`nf-test test main.nf.test -profile test,docker`).
 - [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir <OUTDIR>`).
 - [ ] Usage Documentation in `docs/usage.md` is updated.
 - [ ] Output Documentation in `docs/output.md` is updated.

.github/workflows/awsfulltest.yml

@@ -14,7 +14,7 @@ jobs:
     runs-on: ubuntu-latest
     steps:
       - name: Launch workflow via tower
-        uses: seqeralabs/action-tower-launch@922e5c8d5ac4e918107ec311d2ebbd65e5982b3d # v2
+        uses: seqeralabs/action-tower-launch@v2
         # Add full size test data (but still relatively small datasets for few samples)
         # on the `test_full.config` test runs with only one set of parameters
         with:
@@ -30,7 +30,7 @@ jobs:
             }
           profiles: test_full
 
-      - uses: actions/upload-artifact@5d5d22a31266ced268874388b861e4b58bb5c2f3 # v4
+      - uses: actions/upload-artifact@v4
         with:
           name: Tower debug log file
           path: |

.github/workflows/awstest.yml

@@ -12,7 +12,7 @@ jobs:
     steps:
       # Launch workflow using Tower CLI tool action
       - name: Launch workflow via tower
-        uses: seqeralabs/action-tower-launch@922e5c8d5ac4e918107ec311d2ebbd65e5982b3d # v2
+        uses: seqeralabs/action-tower-launch@v2
         with:
           workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }}
           access_token: ${{ secrets.TOWER_ACCESS_TOKEN }}
@@ -25,7 +25,7 @@ jobs:
             }
           profiles: test
 
-      - uses: actions/upload-artifact@5d5d22a31266ced268874388b861e4b58bb5c2f3 # v4
+      - uses: actions/upload-artifact@v4
         with:
           name: Tower debug log file
           path: |

.github/workflows/ci.yml

@@ -36,7 +36,7 @@ jobs:
         uses: actions/checkout@b4ffde65f46336ab88eb53be808477a3936bae11 # v4
 
       - name: Install Nextflow
-        uses: nf-core/setup-nextflow@b9f764e8ba5c76b712ace14ecbfcef0e40ae2dd8 # v1
+        uses: nf-core/setup-nextflow@v1
         with:
           version: "${{ matrix.NXF_VER }}"
 

.github/workflows/download_pipeline.yml

@@ -28,7 +28,7 @@ jobs:
     runs-on: ubuntu-latest
     steps:
       - name: Install Nextflow
-        uses: nf-core/setup-nextflow@b9f764e8ba5c76b712ace14ecbfcef0e40ae2dd8 # v1
+        uses: nf-core/setup-nextflow@v1
 
       - uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5
         with:

.github/workflows/linting.yml

@@ -35,7 +35,7 @@ jobs:
         uses: actions/checkout@b4ffde65f46336ab88eb53be808477a3936bae11 # v4
 
       - name: Install Nextflow
-        uses: nf-core/setup-nextflow@b9f764e8ba5c76b712ace14ecbfcef0e40ae2dd8 # v1
+        uses: nf-core/setup-nextflow@v1
 
       - uses: actions/setup-python@0a5c61591373683505ea898e09a3ea4f39ef2b9c # v5
         with:

.github/workflows/release-announcements.yml

@@ -12,7 +12,7 @@ jobs:
       - name: get topics and convert to hashtags
         id: get_topics
         run: |
-          curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ' > $GITHUB_OUTPUT
+          curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ' >> $GITHUB_OUTPUT
 
       - uses: rzr/fediverse-action@master
         with:

.gitpod.yml

@@ -10,13 +10,11 @@ tasks:
 
 vscode:
   extensions: # based on nf-core.nf-core-extensionpack
-    - codezombiech.gitignore # Language support for .gitignore files
-    # - cssho.vscode-svgviewer                 # SVG viewer
     - esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code
-    - eamodio.gitlens # Quickly glimpse into whom, why, and when a line or code block was changed
     - EditorConfig.EditorConfig # override user/workspace settings with settings found in .editorconfig files
     - Gruntfuggly.todo-tree # Display TODO and FIXME in a tree view in the activity bar
     - mechatroner.rainbow-csv # Highlight columns in csv files in different colors
-    # - nextflow.nextflow                      # Nextflow syntax highlighting
+    # - nextflow.nextflow                    # Nextflow syntax highlighting
     - oderwat.indent-rainbow # Highlight indentation level
     - streetsidesoftware.code-spell-checker # Spelling checker for source code
+    - charliermarsh.ruff # Code linter Ruff

CHANGELOG.md

@@ -3,6 +3,22 @@
 The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/)
 and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html).
 
+## v2.3.1 - 2024-04-18 - Gray Zinc Dalmation Patch
+
+- [[#328]](https://github.com/nf-core/smrnaseq/pull/328) - Fix [casting issue](https://github.com/nf-core/smrnaseq/issues/327) in mirtrace module
+- [[#334]](https://github.com/nf-core/smrnaseq/pull/334) - Fix [input channel cardinality](https://github.com/nf-core/smrnaseq/issues/331) in `MIRDEEP2_RUN` module
+- [[#334]](https://github.com/nf-core/smrnaseq/pull/334) - Fix [bowtie conda version](https://github.com/nf-core/smrnaseq/issues/333) in `BOWTIE_MAP_SEQ` module
+- [[#335]](https://github.com/nf-core/smrnaseq/pull/335) - Final fix for [casting issue](https://github.com/nf-core/smrnaseq/issues/327) in mirtrace module
+- [[#337]](https://github.com/nf-core/smrnaseq/pull/337) - Fix [three_prime_adapter issue](https://github.com/nf-core/smrnaseq/issues/326), allow `auto-detect` as value
+- [[#342]](https://github.com/nf-core/smrnaseq/pull/342) - Fix [phred offset issue](https://github.com/nf-core/smrnaseq/issues/341), allow specifying phred offset for FASTQ files
+- [[#343]](https://github.com/nf-core/smrnaseq/pull/343) - Fix [mirdeep2 output missing](https://github.com/nf-core/smrnaseq/issues/330), fix mirdeep2 outputs missing in outdir
+
+### Software dependencies
+
+| Dependency | Old version | New version |
+| ---------- | ----------- | ----------- |
+| `multiqc`  | 1.20        | 1.21        |
+
 ## v2.3.0 - 2024-02-23 - Gray Zinc Dalmatian
 
 - [[#307]](https://github.com/nf-core/smrnaseq/pull/307) - Clean up config file and improve output folder structure

README.md

@@ -5,15 +5,15 @@
   </picture>
 </h1>
 
-[![GitHub Actions CI Status](https://github.com/nf-core/smrnaseq/workflows/nf-core%20CI/badge.svg)](https://github.com/nf-core/smrnaseq/actions?query=workflow%3A%22nf-core+CI%22)
-[![GitHub Actions Linting Status](https://github.com/nf-core/smrnaseq/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/smrnaseq/actions?query=workflow%3A%22nf-core+linting%22)
-[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/smrnaseq/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.3456879-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.3456879)
+[![GitHub Actions CI Status](https://github.com/nf-core/smrnaseq/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/smrnaseq/actions/workflows/ci.yml)
+[![GitHub Actions Linting Status](https://github.com/nf-core/smrnaseq/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/smrnaseq/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/smrnaseq/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.10696391?labelColor=000000)](https://doi.org/10.5281/zenodo.10696391)
+[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)
 
 [![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/)
 [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)
 [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/)
 [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/)
-[![Launch on Nextflow Tower](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Nextflow%20Tower-%234256e7)](https://tower.nf/launch?pipeline=https://github.com/nf-core/smrnaseq)
+[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://tower.nf/launch?pipeline=https://github.com/nf-core/smrnaseq)
 
 [![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23smrnaseq-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/smrnaseq)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core)
 

assets/multiqc_config.yml

@@ -1,7 +1,7 @@
 report_comment: >
-  This report has been generated by the <a href="https://github.com/nf-core/smrnaseq/releases/tag/2.3.0" target="_blank">nf-core/smrnaseq</a>
+  This report has been generated by the <a href="https://github.com/nf-core/smrnaseq/releases/tag/2.3.1" target="_blank">nf-core/smrnaseq</a>
   analysis pipeline. For information about how to interpret these results, please see the
-  <a href="https://nf-co.re/smrnaseq/2.3.0/docs/output" target="_blank">documentation</a>.
+  <a href="https://nf-co.re/smrnaseq/2.3.1/docs/output" target="_blank">documentation</a>.
 
 report_section_order:
   "nf-core-smrnaseq-methods-description":

conf/modules.config

@@ -47,12 +47,12 @@ process {
     //
     withName: '.*:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP' {
         ext.args = [ "",
-            params.trim_fastq                  ? "" : "--disable_adapter_trimming",
-            params.clip_r1 > 0                 ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
-            params.three_prime_clip_r1 > 0     ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
-            params.fastp_min_length > 0        ? "-l ${params.fastp_min_length}" : "",
-            params.fastp_max_length > 0        ? "--max_len1 ${params.fastp_max_length}" : "",
-            params.three_prime_adapter == null ?  '' : "--adapter_sequence ${params.three_prime_adapter}"
+            params.trim_fastq                           ? "" : "--disable_adapter_trimming",
+            params.clip_r1 > 0                          ? "--trim_front1 ${params.clip_r1}" : "", // Remove bp from the 5' end of read 1.
+            params.three_prime_clip_r1 > 0              ? "--trim_tail1 ${params.three_prime_clip_r1}" : "", // Remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
+            params.fastp_min_length > 0                 ? "-l ${params.fastp_min_length}" : "",
+            params.fastp_max_length > 0                 ? "--max_len1 ${params.fastp_max_length}" : "",
+            params.three_prime_adapter == "auto-detect" ?  "" : "--adapter_sequence ${params.three_prime_adapter}"
         ].join(" ").trim()
         publishDir = [
             [
@@ -329,14 +329,14 @@ process {
     //
     // MIRDEEP
     //
-    withName: 'MIRDEEP2_MAPPER' {
+    withName: 'NFCORE_SMRNASEQ:MIRDEEP2:MIRDEEP2_MAPPER' {
         publishDir = [
             path: { "${params.outdir}/mirdeep2/mapper" },
             mode: params.publish_dir_mode,
             saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
         ]
     }
-    withName: 'MIRDEEP2_RUN' {
+    withName: 'NFCORE_SMRNASEQ:MIRDEEP2:MIRDEEP2_RUN' {
         publishDir = [
             path: { "${params.outdir}/mirdeep2/run" },
             mode: params.publish_dir_mode,

docs/output.md

@@ -153,7 +153,7 @@ MultiQC reports the number of reads that were removed by each of the contaminant
 
 ## miRTrace
 
-[miRTrace](https://github.com/friedlanderlab/mirtrace) is a quality control specifically for small RNA sequencing data (smRNA-Seq). Each sample is characterized by profiling sequencing quality, read length, sequencing depth and miRNA complexity and also the amounts of miRNAs versus undesirable sequences (derived from tRNAs, rRNAs and sequencing artifacts).
+[miRTrace](https://github.com/friedlanderlab/mirtrace) is a quality control specifically for small RNA sequencing data (smRNA-Seq). Each sample is characterized by profiling sequencing quality, read length, sequencing depth and miRNA complexity and also the amounts of miRNAs versus undesirable sequences (derived from tRNAs, rRNAs and sequencing artifacts). By default, the pipeline sets the PHRED-offset to the most common +33, so if you need to adjust this, use the `params.phred_offset` option to include this accordingly for your FASTQ files.
 
 **Output directory: `results/mirtrace`**
 

docs/usage.md

@@ -18,7 +18,7 @@ This option indicates the experimental protocol used for the sample preparation.
 
 The parameter `--three_prime_adapter` is set to the Illumina TruSeq single index adapter sequence `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`. This is also to ensure, that the auto-detect functionality of `FASTP` is disabled. Please make sure to adapt this adapter sequence accordingly for your run.
 
-:warning: At least the `custom` protocol has to be specified, otherwise the pipeline won't run. In case you specify the `custom` protocol, ensure that the parameters above are set accordingly or the defaults will be applied. If you want to auto-detect the adapters using `fastp`, please set `--three_prime_adapter` to `""`.
+:warning: At least the `custom` protocol has to be specified, otherwise the pipeline won't run. In case you specify the `custom` protocol, ensure that the parameters above are set accordingly or the defaults will be applied. If you want to auto-detect the adapters using `fastp`, please set `--three_prime_adapter` to `auto-detect`.
 
 ### `mirtrace_species` or `mirgenedb_species`