Merge pull request #34 from KevinMenden/master

small doc fix
nf-core · Feb 7, 2020 · 7a139ec · 7a139ec
2 parents 4143487 + 1a99cd6
commit 7a139ec
Show file tree

Hide file tree

Showing 2 changed files with 5 additions and 1 deletion.
diff --git a/README.md b/README.md
@@ -6,6 +6,10 @@
 [![install with bioconda](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg)](http://bioconda.github.io/)
 [![Docker](https://img.shields.io/docker/automated/nfcore/smrnaseq.svg)](https://hub.docker.com/r/nfcore/smrnaseq)
 
+[![DOI](https://zenodo.org/badge/140590861.svg)](https://zenodo.org/badge/latestdoi/140590861)
+
+
+
 ## Introduction
 **nf-core/smrnaseq** is a bioinformatics best-practice analysis pipeline used for small RNA sequencing data.
 

diff --git a/docs/usage.md b/docs/usage.md
@@ -144,7 +144,7 @@ Default: "illumina"
 | illumina      | Illumina TruSeq Small RNA               | clip_R1 = 0; three_prime_clip_R1 = 0 | TGGAATTCTCGGGTGCCAAGG |
 | nextflex      | BIOO SCIENTIFIC  NEXTFLEX Small RNA-Seq | clip_R1 = 4; three_prime_clip_R1 = 4 | TGGAATTCTCGGGTGCCAAGG |
 | qiaseq        | QIAGEN QIAseq miRNA                     | clip_R1 = 0; three_prime_clip_R1 = 0 | AACTGTAGGCACCATCAAT   |
-| cats          | Diagenode CATS Small RNA-seq            | clip_R1 = 3; three_prime_clip_R1 = 0 | GATCGGAAGAGCACACGTCTG |
+| cats          | Diagenode CATS Small RNA-seq            | clip_R1 = 3; three_prime_clip_R1 = 0 | AAAAAAAAAAA + GATCGGAAGAGCACACGTCTG (only polyA is used for trimming) |
 
 ## Reference genomes