Trim3p nextflex #386

lpantano · 2024-08-23T22:00:53Z

This PR is trying to add the right 3 end trimming after adapter removal for next flex protocol, where some NT needs to be removed from the end, but after adapter removal.

I couldn't figure out a way to reuse the fastp twice in row because the symlinks input/outputs, so if somebody has an idea, happy to implement, for now I added it as local module to run only for next flex.

I have test data to add, if we all are ok with this approach.

PR checklist

github-actions · 2024-08-23T22:34:05Z

`nf-core lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit 7a15447

+| ✅ 217 tests passed       |+
#| ❔   1 tests were ignored |#
!| ❗   3 tests had warnings |!

❗ Test warnings:

pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!

❔ Tests ignored:

nextflow_config - Config default ignored: params.fastp_known_mirna_adapters

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .editorconfig
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/ci.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-smrnaseq_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-smrnaseq_logo_light.png
files_exist - File found: docs/images/nf-core-smrnaseq_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-smrnaseq_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowSmrnaseq.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: params.validationShowHiddenParams
nextflow_config - Config variable found: params.validationSchemaIgnoreParams
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config manifest.version ends in dev: 2.3.2dev
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.protocol= custom
nextflow_config - Config default value correct: params.umitools_extract_method= string
nextflow_config - Config default value correct: params.umitools_method= dir
nextflow_config - Config default value correct: params.skip_umi_extract_before_dedup= true
nextflow_config - Config default value correct: params.mature= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa
nextflow_config - Config default value correct: params.hairpin= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa
nextflow_config - Config default value correct: params.save_aligned_mirna_quant= true
nextflow_config - Config default value correct: params.three_prime_adapter= AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
nextflow_config - Config default value correct: params.trim_fastq= true
nextflow_config - Config default value correct: params.fastp_min_length= 17
nextflow_config - Config default value correct: params.fastp_max_length= 100
nextflow_config - Config default value correct: params.min_trimmed_reads= 10
nextflow_config - Config default value correct: params.save_merged= true
nextflow_config - Config default value correct: params.phred_offset= 33
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.max_cpus= 16
nextflow_config - Config default value correct: params.max_memory= 128.GB
nextflow_config - Config default value correct: params.max_time= 240.h
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-smrnaseq_logo_light.png matches the template
files_unchanged - docs/images/nf-core-smrnaseq_logo_light.png matches the template
files_unchanged - docs/images/nf-core-smrnaseq_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_ci - '.github/workflows/ci.yml' is triggered on expected events
actions_ci - '.github/workflows/ci.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 23.04.0, Config: 23.04.0
readme - README Zenodo placeholder was replaced with DOI.
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (268 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: fix-linting.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: ci.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
modules_config - conf/modules.config found and not ignored.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - CAT_FASTQ found in conf/modules.config and Nextflow scripts.
modules_config - FASTP_LENGTH_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - INDEX_GENOME found in conf/modules.config and Nextflow scripts.
modules_config - UMITOOLS_EXTRACT found in conf/modules.config and Nextflow scripts.
modules_config - MIRTRACE_RUN found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - EDGER_QC found in conf/modules.config and Nextflow scripts.
modules_config - SEQCLUSTER_SEQUENCES found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - MIRTOP_QUANT found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 2.14.1

Run details

nf-core/tools version 2.14.1
Run at 2024-09-06 21:19:30

apeltzer · 2024-08-26T20:34:15Z

Could you upload the testdata and prepare a testcase for this already? That way we could test more easily if the results match expectations, even when trying to solve this without a local module 👍🏻

lpantano · 2024-08-26T21:21:05Z

sounds good, I will do that ASAP, I checked that sequences were matching reference miRNA, so that is good. I will ping again when is ready.

apeltzer · 2024-08-27T07:37:19Z

One idea would be to run the fastp module multiple times and use the stageIn directive to copy instead of symlink. That should be possible via the modules.config without having to worry about the data being changed.

lpantano · 2024-08-29T16:16:38Z

I added the test data, not running in ci right now, but we can add it if we want. With this subsampled test data, the majority of the reads map to reference, if you don't running with next flex then all are isomiRs, because of the lack of trimming. So, I think is working.

conf/modules.config

conf/test_no_genome_nextflex.config

modules/local/trim3p.nf

workflows/smrnaseq.nf

lpantano · 2024-09-05T14:22:07Z

Ok, I will close this later and open an issue with the propose strategy and see if somebody has time to do it at some point. I will refer to this branch meanwhile for people that has this data to get something working. Thanks.

…

On Sep 5, 2024 at 09:23 -0400, Alexander Peltzer ***@***.***>, wrote: @apeltzer commented on this pull request. In workflows/smrnaseq.nf: > @@ -7,6 +7,7 @@ include { CAT_FASTQ } from '../modules/nf-core/cat/fastq/ include { CONTAMINANT_FILTER } from '../subworkflows/local/contaminant_filter' include { FASTQC } from '../modules/nf-core/fastqc/main' include { FASTQ_FASTQC_UMITOOLS_FASTP } from '../subworkflows/nf-core/fastq_fastqc_umitools_fastp' +include { FASTP3 } from '../modules/local/trim3p.nf' @nschcolnicov / @atrigila and myself just discussed it again and it should work the way @nschcolnicov just mentioned and also supplying the stageInMode: 'copy' in the modules.config for the FASTP3 then. — Reply to this email directly, view it on GitHub, or unsubscribe. You are receiving this because you were mentioned.Message ID: ***@***.***>

apeltzer · 2024-09-05T14:42:19Z

I think we can just use your branch and add the fix, we can likely also help with that to try if the strategy works indeed. The main fix will stay untouched - its just not using a local module to achieve the same thing :)

apeltzer · 2024-09-05T14:52:40Z

Ran the pipeline like this now:

nextflow run . -profile docker,nextflex --outdir nextflex --input https://raw.githubusercontent.com/nf-core/test-datasets/smrnaseq/samplesheet/v2.0/samplesheet_test_nextflex.csv  --
genome 'GRCh37' --mirtrace_species 'hsa'

lpantano · 2024-09-05T15:21:21Z

@apeltzer , isn't that command need the -profile docker,nextflex ?

apeltzer · 2024-09-05T17:28:14Z

Absolutely, added that in

Updating nextflex branch

nschcolnicov · 2024-09-06T15:03:14Z

@lpantano @apeltzer @atrigila Should be good to go now, please review.

atrigila

LGTM

lpantano · 2024-09-06T15:56:49Z

I will run it later (give me a couple of hours) to check results, and make sure we have the right trimming. I am sure it is right, but good to double check, thanks!

apeltzer · 2024-09-06T15:58:11Z

Sounds good - we could also add a test 👍

apeltzer · 2024-09-06T15:58:39Z

Ah sorry there is one, let's test if trimming looks good and then merge if ok

lpantano · 2024-09-06T16:01:20Z

yes, I will mainly do that, need to look a little closely, mainly checking that plot in multiqc looks like that

lpantano · 2024-09-06T17:33:26Z

When I ran:

nextflow run main.nf -profile docker,test_nextflex --outdir

Mirtop doesn't run anymore. It should be after NFCORE_SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_MATURE. Are you getting Mirtop running with this?

lpantano

This line

smrnaseq/subworkflows/local/prepare_genome/main.nf

Line 37 in 1a8a68e

    
           ch_mirna_gtf              = val_mirna_gtf                 ? Channel.empty() : ( mirna_gtf_from_species ? Channel.fromPath(mirna_gtf_from_species, checkIfExists: true).collect() :  Channel.empty() )    //TODO for ch_mirna_gtf, shouldn't it try to build a channel.fromPath with params.mirna_gtf,  if true? (instead of setting it to empty). Is this parameter used for non mirgenedb runs?

is making not to setup the ch_mirna_gtf, when the user gives param.mirna_gtf, I don't think that is what we want right? it is not related to this PR, actually affecting everything.

There is a comment actually there, that we should implement:

//TODO for ch_mirna_gtf, shouldn't it try to build a channel.fromPath with params.mirna_gtf,  if true? (instead of setting it to empty). Is this parameter used for non mirgenedb runs?

lpantano · 2024-09-06T19:01:37Z

Otherwise, the trimming is working. If we fix that TODO it would be great, right now is skipping the miRNA quantification if people set that parameter.

nschcolnicov · 2024-09-06T19:40:13Z

This line

smrnaseq/subworkflows/local/prepare_genome/main.nf

Line 37 in 1a8a68e

ch_mirna_gtf = val_mirna_gtf ? Channel.empty() : ( mirna_gtf_from_species ? Channel.fromPath(mirna_gtf_from_species, checkIfExists: true).collect() : Channel.empty() ) //TODO for ch_mirna_gtf, shouldn't it try to build a channel.fromPath with params.mirna_gtf, if true? (instead of setting it to empty). Is this parameter used for non mirgenedb runs?

is making not to setup the ch_mirna_gtf, when the user gives param.mirna_gtf, I don't think that is what we want right? it is not related to this PR, actually affecting everything.

There is a comment actually there, that we should implement:
//TODO for ch_mirna_gtf, shouldn't it try to build a channel.fromPath with params.mirna_gtf,  if true? (instead of setting it to empty). Is this parameter used for non mirgenedb runs?

Thanks for looking into this, I agree, it doesnt look right

atrigila · 2024-09-06T21:04:25Z

@lpantano I think the change introduced in the last commit fixed this issue, as I can now see that mirtop run. Would you mind checking from your side? I can then focus on updating the CI tests.

lpantano · 2024-09-06T21:06:34Z

yes, that is true. That change makes mirtop to run.

lpantano · 2024-09-06T21:42:24Z

please, somebody go a merge this!!!!!!!!!!!!!!!!! what a way to end the week :)

lpantano added 3 commits August 23, 2024 16:31

add trim3p N nts

b904521

Merge branch 'dev' of github.com:nf-core/smrnaseq into dev

34c137b

not track logs for this extra step

51a6dc0

lpantano changed the base branch from master to dev August 23, 2024 22:01

This comment was marked as outdated.

Sign in to view

lpantano added 2 commits August 23, 2024 18:04

fix lint

16e1287

move fastp2 module to main workflow

0c5222a

lpantano marked this pull request as ready for review August 26, 2024 20:25

lpantano added 2 commits August 29, 2024 10:49

add nextflex file

79447ee

fix step name to match module.config

6c22349

add changelog

bc228d3

atrigila reviewed Aug 30, 2024

View reviewed changes

conf/modules.config Outdated Show resolved Hide resolved

conf/test_no_genome_nextflex.config Outdated Show resolved Hide resolved

modules/local/trim3p.nf Outdated Show resolved Hide resolved

workflows/smrnaseq.nf Outdated Show resolved Hide resolved

nschcolnicov reviewed Aug 30, 2024

View reviewed changes

workflows/smrnaseq.nf Outdated Show resolved Hide resolved

lpantano closed this Sep 5, 2024

lpantano mentioned this pull request Sep 5, 2024

Fix Nextflex 4nt 3p trimming #407

Closed

apeltzer reopened this Sep 5, 2024

zxBIB Schcolnicov and others added 4 commits September 6, 2024 15:13

fastp3 fix

ec1001e

Pulled from dev

d34fddb

Added nftest

669f7e1

Merge pull request #412 from nschcolnicov/nextflex

1a8a68e

Updating nextflex branch

nschcolnicov added the ready for review label Sep 6, 2024

atrigila reviewed Sep 6, 2024

View reviewed changes

atrigila approved these changes Sep 6, 2024

View reviewed changes

lpantano commented Sep 6, 2024

View reviewed changes

lpantano mentioned this pull request Sep 6, 2024

Possible bug in logic code related to mature, hairpin and species setup #414

Closed

Update main.nf

046757e

update ci tests nextflex

7a15447

apeltzer merged commit f7cd5ba into dev Sep 7, 2024
6 checks passed

apeltzer deleted the trim3p_nextflex branch September 20, 2024 08:04

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Trim3p nextflex #386

Trim3p nextflex #386

lpantano commented Aug 23, 2024 •

edited

Loading

This comment was marked as outdated.

github-actions bot commented Aug 23, 2024 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

apeltzer commented Aug 26, 2024

lpantano commented Aug 26, 2024

apeltzer commented Aug 27, 2024

lpantano commented Aug 29, 2024

lpantano commented Sep 5, 2024 via email

apeltzer commented Sep 5, 2024

apeltzer commented Sep 5, 2024 •

edited

Loading

lpantano commented Sep 5, 2024

apeltzer commented Sep 5, 2024

nschcolnicov commented Sep 6, 2024

atrigila left a comment

lpantano commented Sep 6, 2024

apeltzer commented Sep 6, 2024

apeltzer commented Sep 6, 2024

lpantano commented Sep 6, 2024

lpantano commented Sep 6, 2024

lpantano left a comment

lpantano commented Sep 6, 2024

nschcolnicov commented Sep 6, 2024

atrigila commented Sep 6, 2024

lpantano commented Sep 6, 2024

lpantano commented Sep 6, 2024

Trim3p nextflex #386

Trim3p nextflex #386

Conversation

lpantano commented Aug 23, 2024 • edited Loading

PR checklist

This comment was marked as outdated.

github-actions bot commented Aug 23, 2024 • edited Loading

nf-core lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

apeltzer commented Aug 26, 2024

lpantano commented Aug 26, 2024

apeltzer commented Aug 27, 2024

lpantano commented Aug 29, 2024

lpantano commented Sep 5, 2024 via email

apeltzer commented Sep 5, 2024

apeltzer commented Sep 5, 2024 • edited Loading

lpantano commented Sep 5, 2024

apeltzer commented Sep 5, 2024

nschcolnicov commented Sep 6, 2024

atrigila left a comment

Choose a reason for hiding this comment

lpantano commented Sep 6, 2024

apeltzer commented Sep 6, 2024

apeltzer commented Sep 6, 2024

lpantano commented Sep 6, 2024

lpantano commented Sep 6, 2024

lpantano left a comment

Choose a reason for hiding this comment

lpantano commented Sep 6, 2024

nschcolnicov commented Sep 6, 2024

atrigila commented Sep 6, 2024

lpantano commented Sep 6, 2024

lpantano commented Sep 6, 2024

lpantano commented Aug 23, 2024 •

edited

Loading

github-actions bot commented Aug 23, 2024 •

edited

Loading

`nf-core lint` overall result: Passed ✅ ⚠️

apeltzer commented Sep 5, 2024 •

edited

Loading