forna-serve

Forna-serve wraps a custom ViennaRNA forna web-server, to display and edit RNA triplexes as shown in the TriplexRNA database.

• Installation requirements
• Run forna-serve
• Usage
  • URL syntax
  • Example

Installation requirements

The only requirement is Docker, which can be installed in different ways depending on the underlying operative system:

• Unix users should follow the Docker installation for Linux
• MacOS 10.13+ users should follow the Docker installation for Mac
• Windows 10+ users, should follow the Docker installation for Windows
• For legacy systems, users can rely on the Docker Toolbox.

▲ back to top

Run forna-serve

To run forna-serve, you need to run its docker container. Type:

docker run -d -p 9090:8080 quay.io/bagnacan/forna-serve

The forna-serve web-service is now listening on your host's port 9090. You can test its docker container by opening your browser, and type:

localhost:9090/ping

You should receive a pong reply. If so, the service is up and running!
You can now send proper forna queries to visualize and edit RNA triplexes.

▲ back to top

Usage

Here we explain the URL syntax that is required for requesting RNA triplex visualizations, and provide a sample query.

▲ back to top

URL syntax

The syntax to visualize RNA molecules is based on the one defined by forna, and extended to distinguish the different RNAs of a triplex:

1. Host
   If you are running the forna-serve container on your localhost, this will likely look like http://localhost:9090/

2. Triplex identifier
   A name for the visualized triplex T, which must be provided as ?id=url/T

3. Sequence
   The full sequence S of the complex, to be provided as &sequence=S

4. Structure
   The dot-bracket notation D of the complex, to be provided by &structure=D

5. Target gene
   The target gene name G, &gene=G

6. 1st miRNA
   The 1st miRNA name M1, &mirna1=M1

7. 2nd miRNA
   The 2nd miRNA name M2, &mirna2=M2

8. Colors
   The color scheme of the 3 different segments, to be counted in nucleotides.
   Supposing that:

• G should be colored lightgrey, its sequence starts at nt. 1, and ends at nt. GL
• M1 should be colored lightgreen, its sequence starts at nt. GL+1 and ends at nt. M1L
• M2 should be colored red, its sequence starts at nt. M1L+1 and ends at nt. M2L
  The scheme of the triplex T will be: &colors=>T\n1-GL:lightgrey\nGL+1-M1L:lightgreen\nM1L+1-M2L:red

▲ back to top

Example

Using the aforementioned syntax, we compose a URL to display the RNA triplex 97544.

The triplex is formed by Human (hg19) target gene E2F1, miRNA hsa-miR-205, and miRNA hsa-miR-342-3p.

1. Host
   http://localhost:9090
2. Triplex identifier
   ?id=url/97544
3. Sequence
   &sequence=ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaagguuccuucauuccaccggagucugucucacacagaaaucgcacccgu
   Where:
   • E2F1 ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaaggu
   • hsa-miR-205 uccuucauuccaccggagucug
   • hsa-miR-342-3p ucucacacagaaaucgcacccgu
4. Structure
   &structure=.((((.((((.(.(((((((((((((......)))))..((((((((((((((..)))))))))).)))).......))))))))..).)))).)))).
5. Target gene
   &gene=E2F1
6. 1st miRNA
   &mirna1=hsa-miR-205
7. 2nd miRNA
   &mirna2=hsa-miR-342-3p
8. Colors
   &colors=%3E97544\n1-54:lightgray\n55-76:lightgreen\n77-99:red
   Where:
   • E2F1's sequence starts at nt. 1 and ends at nt. 54 (lightgray)
   • hsa-miR-205's sequence starts at nt. 5 and ends at nt. 76 (lightgreen)
   • hsa-miR-342-3p's sequence starts at nt. 77 and ends at nt. 99 (red)

You can now assemble the full URL, and type it in the browser:

http://localhost:9090/?id=url/97544&sequence=ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaagguuccuucauuccaccggagucugucucacacagaaaucgcacccgu&structure=.((((.((((.(.(((((((((((((......)))))..((((((((((((((..)))))))))).)))).......))))))))..).)))).)))).&gene=E2F1&mirna1=hsa-miR-205&mirna2=hsa-miR-342-3p&colors=%3E97544\n1-54:lightgray\n55-76:lightgreen\n77-99:red

You will visualize something like this:

▲ back to top