Transcriptomics Digestion and Fragmentation (#801)

* Added in base classes

* Implemented all tests

* Made initial tests pass

* Removed unnecessary namespaces

* Expanded test coverage

* Responded to Alex Comments

* Add RNA support: loading, parsing, and decoy generation

Introduced support for handling RNA data within the UsefulProteomicsDatabases project. Key changes include:

- Added `Transcriptomics\TestData` folder to `Test.csproj`.
- Changed access modifiers in `ProteinDbLoader.cs` to internal.
- Added `using` directives for `Transcriptomics` in `ProteinXmlEntry.cs`.
- Introduced methods `ParseRnaEndElement` and `ParseRnaEntryEndElement` in `ProteinXmlEntry.cs`.
- Modified `ParseAnnotatedMods` to check for RNA modifications.
- Added project reference to `Transcriptomics.csproj` in `UsefulProteomicsDatabases.csproj`.
- Added `ClassExtensions.cs` with `CreateNew` method for nucleic acids.
- Added `RnaDbLoader.cs` for RNA database loading.
- Added `RnaDecoyGenerator.cs` for generating decoy RNA sequences.

* Add new properties and caching to oligo digestion

Updated `using` directives in `TestDigestion.cs` and `OligoWithSetMods.cs` to include necessary namespaces. Added assertions in `TestDigestion.cs` for `SequenceWithChemicalFormulas` and `FullSequenceWithMassShift`. Changed `namespace` in `OligoWithSetMods.cs` to `Transcriptomics.Digestion`. Implemented and cached `SequenceWithChemicalFormulas` property in `OligoWithSetMods.cs`.

* Add RNA sequence and database handling and related test cases

- Added new files `ModomicsUnmodifiedTrimmed.fasta` and `ModomicsUnmodifiedTrimmed.fasta.gz` to `Test.csproj` with `CopyToOutputDirectory` set to `PreserveNewest`.
- Removed the `Transcriptomics\TestData` folder from `Test.csproj`.
- Introduced `Transcribe` method in `ClassExtensions.cs` for DNA to RNA transcription.
- Added summary comment to `NucleolyticOligo` class in `NucleolyticOligo.cs`.
- Added `ApplyRegex` method in `FastaHeaderFieldRegex.cs`.
- Introduced `ProteinDbWriter` class in `ProteinDbWriter.cs` for writing protein and nucleic acid databases.
- Modified `GetModsForThisProtein` to `GetModsForThisBioPolymer` in `ProteinDbWriter.cs`.
- Added `RnaDbLoader` class in `RnaDbLoader.cs` for RNA FASTA header detection and sequence loading.
- Updated user dictionary in `mzLib.sln.DotSettings` with new terms.
- Added test cases in `TestDbLoader.cs` for RNA database loading and header detection.
- Introduced `TestDecoyGeneration` class in `TestDecoyGenerator.cs` for RNA decoy generation tests.
- Added RNA sequence file `ModomicsUnmodifiedTrimmed.fasta` and its compressed version.

* Refactor and enhance RNA and oligo handling in tests

- Added `using` directives for `Transcriptomics.Digestion` and `UsefulProteomicsDatabases.Transcriptomics` in `TestDecoyGenerator.cs`.
- Introduced `TestCreateNew` in `TestDecoyGenerator.cs` to verify RNA and oligo creation.
- Added `using` directive for `MzLibUtil` in `TestDigestion.cs`.
- Added a test in `TestDigestion.cs` for exception handling with invalid sequences.
- Added `using` directives for `Omics` and related namespaces in `TestFragmentation.cs`.
- Modified `TestFragmentation_Modified` in `TestFragmentation.cs` to use `OligoWithSetMods` directly and added assertions.
- Updated `ClassExtensions.cs` to allow setting `isDecoy` in new `RNA` objects.
- Refactored `OligoWithSetMods.cs` to return a dictionary from `GetModsAfterDeserialization`.
- Updated `OligoWithSetMods.cs` to initialize `_allModsOneIsNterminus` using the returned dictionary.

* Broke out TerminusSpecificProductTypes class and removed unnecessary namespaces

* Update ProteinXmlEntry.cs

* Added gene name to RNA constructore

* Added gene name to RNA constructore

* Refactor and enhance exception handling and tests

Refactored constructors, improved exception handling, and added comprehensive tests across multiple files. Key changes include:

- `MzLibException.cs`: Updated constructor to include `innerException`.
- `TestDecoyGenerator.cs`: Added assertions for `CreateNew` method.
- `TestDigestion.cs`: Added assertions and new test for RNA digestion exception.
- Refactored modification lists and added various tests for modifications.
- `TestNucleicAcid.cs`: Refactored methods, adjusted precision, and updated terminus assignments.
- `NucleolyticOligo.cs`: Changed parameter types, updated comments, and improved variable names.
- `OligoWithSetMods.cs`: Enhanced exception messages and updated modification location checks.
- `NucleicAcid.cs`: Added `using` directive, changed exception type, and refactored methods.
- `mzLib.sln.DotSettings`: Updated user dictionary entries.

* Add test data files and methods for RNA sequence handling

Added new test data files (`20mer1.fasta`, `20mer1.fasta.gz`, `20mer1.xml`, `20mer1.xml.gz`) to the `Transcriptomics\TestData` directory in the `Test.csproj` file, ensuring they are copied to the output directory. Introduced `TestDbReadingDifferentExtensions` in `TestDbLoader.cs` to verify RNA database reading from various formats. Added `TestDigestionMaxIsoforms` in `TestDigestion.cs` to test RNA sequence digestion with max isoforms. Updated `WriteNucleicAcidXmlDatabase` in `ProteinDbWriter.cs` with remarks for future implementation. Added a TODO in `RnaDecoyGenerator.cs` regarding palindromic sequences' impact on fragment ions. Included new RNA sequence data in test files for validation.

* Added test coverage to the localize method within BioPolymerWithSetMods

---------

Co-authored-by: Nic Bollis <nbollis@wisc.edu>

mzLib/Chemistry/ClassExtensions.cs

@@ -48,6 +48,7 @@ public static double ToMass(this double massToChargeRatio, int charge)
             return Math.Abs(charge) * massToChargeRatio - charge * Constants.ProtonMass;
         }
 
+        public static double? RoundedDouble(this double myNumber, int places = 9) => RoundedDouble(myNumber as double?, places);
         public static double? RoundedDouble(this double? myNumber, int places = 9)
         {
             if (myNumber != null)

mzLib/MassSpectrometry/Enums/DissociationType.cs

@@ -109,6 +109,11 @@ public enum DissociationType
         /// </summary>
         LowCID,
 
+        /// <summary>
+        /// activated ion electron photo detachment dissociation
+        /// </summary>
+        aEPD,
+
         Unknown,
         AnyActivationType,
         Custom,

mzLib/MzLibUtil/MzLibException.cs

@@ -3,11 +3,6 @@
 namespace MzLibUtil
 {
     [Serializable]
-    public class MzLibException : Exception
-    {
-        public MzLibException(string message)
-            : base(message)
-        {
-        }
-    }
+    public class MzLibException(string message, Exception innerException = null) 
+        : Exception(message, innerException);
 }

mzLib/Omics/Fragmentation/FragmentationTerminus.cs

@@ -1,19 +1,12 @@
-using System;
-using System.Collections.Generic;
-using System.Linq;
-using System.Text;
-using System.Threading.Tasks;
-
-namespace Omics.Fragmentation
+namespace Omics.Fragmentation
 {
     public enum FragmentationTerminus
-        {
-            Both, //N- and C-terminus
-            N, //N-terminus only
-            C, //C-terminus only
+    {
+        Both, //N- and C-terminus
+        N, //N-terminus only
+        C, //C-terminus only
         None, //used for internal fragments, could be used for top down intact mass?
         FivePrime, // 5' for NucleicAcids
         ThreePrime, // 3' for NucleicAcids
-        }
-
+    }
 }

mzLib/Omics/Fragmentation/Oligo/TerminusSpecificProductTypes.cs

@@ -0,0 +1,141 @@
+using System;
+using System.Collections.Generic;
+using System.Linq;
+using System.Text;
+using System.Threading.Tasks;
+
+namespace Omics.Fragmentation.Oligo
+{
+    public static class TerminusSpecificProductTypes
+    {
+        public static List<ProductType> GetRnaTerminusSpecificProductTypes(
+            this FragmentationTerminus fragmentationTerminus)
+        {
+            return ProductIonTypesFromSpecifiedTerminus[fragmentationTerminus];
+        }
+
+        /// <summary>
+        /// The types of ions that can be generated from an oligo fragment, based on the terminus of the fragment
+        /// </summary>
+        public static Dictionary<FragmentationTerminus, List<ProductType>> ProductIonTypesFromSpecifiedTerminus = new Dictionary<FragmentationTerminus, List<ProductType>>
+        {
+            { 
+                FragmentationTerminus.FivePrime, new List<ProductType>
+                {
+                    ProductType.a, ProductType.aWaterLoss, ProductType.aBaseLoss,
+                    ProductType.b, ProductType.bWaterLoss, ProductType.bBaseLoss,
+                    ProductType.c, ProductType.cWaterLoss, ProductType.cBaseLoss,
+                    ProductType.d, ProductType.dWaterLoss, ProductType.dBaseLoss,
+                }
+            },
+            { 
+                FragmentationTerminus.ThreePrime, new List<ProductType>
+                {
+                    ProductType.w, ProductType.wWaterLoss, ProductType.wBaseLoss,
+                    ProductType.x, ProductType.xWaterLoss, ProductType.xBaseLoss,
+                    ProductType.y, ProductType.yWaterLoss, ProductType.yBaseLoss,
+                    ProductType.z, ProductType.zWaterLoss, ProductType.zBaseLoss,
+                }
+            },
+            { 
+                FragmentationTerminus.Both, new List<ProductType>
+                {
+
+                    ProductType.a, ProductType.aWaterLoss, ProductType.aBaseLoss,
+                    ProductType.b, ProductType.bWaterLoss, ProductType.bBaseLoss,
+                    ProductType.c, ProductType.cWaterLoss, ProductType.cBaseLoss,
+                    ProductType.d, ProductType.dWaterLoss, ProductType.dBaseLoss,
+                    ProductType.w, ProductType.wWaterLoss, ProductType.wBaseLoss,
+                    ProductType.x, ProductType.xWaterLoss, ProductType.xBaseLoss,
+                    ProductType.y, ProductType.yWaterLoss, ProductType.yBaseLoss,
+                    ProductType.z, ProductType.zWaterLoss, ProductType.zBaseLoss,
+                    ProductType.M
+                }
+
+            },
+            { 
+                FragmentationTerminus.None, new List<ProductType>()
+            }
+        };
+
+
+        public static FragmentationTerminus GetRnaTerminusType(this ProductType fragmentType)
+        {
+            switch (fragmentType)
+            {
+                case ProductType.a:
+                case ProductType.aWaterLoss:
+                case ProductType.aBaseLoss:
+                case ProductType.b:
+                case ProductType.bWaterLoss:
+                case ProductType.bBaseLoss:
+                case ProductType.c:
+                case ProductType.cWaterLoss:
+                case ProductType.cBaseLoss:
+                case ProductType.d:
+                case ProductType.dWaterLoss:
+                case ProductType.dBaseLoss:
+                case ProductType.w:
+                case ProductType.wWaterLoss:
+                case ProductType.wBaseLoss:
+                case ProductType.x:
+                case ProductType.xWaterLoss:
+                case ProductType.xBaseLoss:
+                case ProductType.y:
+                case ProductType.yWaterLoss:
+                case ProductType.yBaseLoss:
+                case ProductType.z:
+                case ProductType.zWaterLoss:
+                case ProductType.zBaseLoss:
+                case ProductType.M:
+                    return ProductTypeToFragmentationTerminus[fragmentType];
+
+                case ProductType.aStar:
+                case ProductType.aDegree:
+                case ProductType.bAmmoniaLoss:
+                case ProductType.yAmmoniaLoss:
+                case ProductType.zPlusOne:
+                case ProductType.D:
+                case ProductType.Ycore:
+                case ProductType.Y:
+                default:
+                    throw new ArgumentOutOfRangeException(nameof(fragmentType), fragmentType, null);
+            }
+        }
+
+
+        /// <summary>
+        /// The terminus of the oligo fragment that the product ion is generated from
+        /// </summary>
+        public static Dictionary<ProductType, FragmentationTerminus> ProductTypeToFragmentationTerminus = new Dictionary<ProductType, FragmentationTerminus>
+        {
+            { ProductType.a, FragmentationTerminus.FivePrime },
+            { ProductType.aWaterLoss, FragmentationTerminus.FivePrime },
+            { ProductType.aBaseLoss, FragmentationTerminus.FivePrime },
+            { ProductType.b, FragmentationTerminus.FivePrime },
+            { ProductType.bWaterLoss, FragmentationTerminus.FivePrime },
+            { ProductType.bBaseLoss, FragmentationTerminus.FivePrime },
+            { ProductType.c, FragmentationTerminus.FivePrime },
+            { ProductType.cWaterLoss, FragmentationTerminus.FivePrime },
+            { ProductType.cBaseLoss, FragmentationTerminus.FivePrime },
+            { ProductType.d, FragmentationTerminus.FivePrime },
+            { ProductType.dWaterLoss, FragmentationTerminus.FivePrime },
+            { ProductType.dBaseLoss, FragmentationTerminus.FivePrime },
+
+            { ProductType.w, FragmentationTerminus.ThreePrime },
+            { ProductType.wWaterLoss, FragmentationTerminus.ThreePrime },
+            { ProductType.wBaseLoss, FragmentationTerminus.ThreePrime },
+            { ProductType.x, FragmentationTerminus.ThreePrime },
+            { ProductType.xWaterLoss, FragmentationTerminus.ThreePrime },
+            { ProductType.xBaseLoss, FragmentationTerminus.ThreePrime },
+            { ProductType.y, FragmentationTerminus.ThreePrime },
+            { ProductType.yWaterLoss, FragmentationTerminus.ThreePrime },
+            { ProductType.yBaseLoss, FragmentationTerminus.ThreePrime },
+            { ProductType.z, FragmentationTerminus.ThreePrime },
+            { ProductType.zWaterLoss, FragmentationTerminus.ThreePrime },
+            { ProductType.zBaseLoss, FragmentationTerminus.ThreePrime },
+
+            { ProductType.M, FragmentationTerminus.Both }
+        };
+    }
+}

mzLib/Omics/IBioPolymerWithSetMods.cs

@@ -50,7 +50,16 @@ public void Fragment(DissociationType dissociationType, FragmentationTerminus fr
         public void FragmentInternally(DissociationType dissociationType, int minLengthOfFragments,
             List<Product> products);
 
-        public IBioPolymerWithSetMods Localize(int j, double massToLocalize);
+        /// <summary>
+        /// Outputs a duplicate IBioPolymerWithSetMods with a localized mass shift, replacing a modification when present
+        /// <remarks>
+        /// Used to localize an unknown mass shift in the MetaMorpheus Localization Engine
+        /// </remarks>
+        /// </summary>
+        /// <param name="indexOfMass">The index of the modification in the AllModOneIsNTerminus Dictionary - 2 (idk why -2)</param>
+        /// <param name="massToLocalize">The mass to add to the BioPolymer</param>
+        /// <returns></returns>
+        public IBioPolymerWithSetMods Localize(int indexOfMass, double massToLocalize);
 
         public static string GetBaseSequenceFromFullSequence(string fullSequence)
         {

mzLib/Proteomics/ProteolyticDigestion/PeptideWithSetModifications.cs

@@ -613,17 +613,17 @@ public void FragmentInternally(DissociationType dissociationType, int minLengthO
             }
         }
 
-        public IBioPolymerWithSetMods Localize(int j, double massToLocalize)
+        public IBioPolymerWithSetMods Localize(int indexOfMass, double massToLocalize)
         {
             var dictWithLocalizedMass = new Dictionary<int, Modification>(AllModsOneIsNterminus);
             double massOfExistingMod = 0;
-            if (dictWithLocalizedMass.TryGetValue(j + 2, out Modification modToReplace))
+            if (dictWithLocalizedMass.TryGetValue(indexOfMass + 2, out Modification modToReplace))
             {
                 massOfExistingMod = (double)modToReplace.MonoisotopicMass;
-                dictWithLocalizedMass.Remove(j + 2);
+                dictWithLocalizedMass.Remove(indexOfMass + 2);
             }
 
-            dictWithLocalizedMass.Add(j + 2, new Modification(_locationRestriction: "Anywhere.", _monoisotopicMass: massToLocalize + massOfExistingMod));
+            dictWithLocalizedMass.Add(indexOfMass + 2, new Modification(_locationRestriction: "Anywhere.", _monoisotopicMass: massToLocalize + massOfExistingMod));
 
             var peptideWithLocalizedMass = new PeptideWithSetModifications(Protein, _digestionParams, OneBasedStartResidueInProtein, OneBasedEndResidueInProtein,
                 CleavageSpecificityForFdrCategory, PeptideDescription, MissedCleavages, dictWithLocalizedMass, NumFixedMods);

mzLib/Test/Test.csproj

@@ -494,6 +494,24 @@
     </None>
     <None Update="FileReadingTests\SearchResults\VariantCrossTest.psmtsv">
       <CopyToOutputDirectory>Always</CopyToOutputDirectory>
+    </None>
+    <None Update="Transcriptomics\TestData\20mer1.fasta">
+      <CopyToOutputDirectory>Always</CopyToOutputDirectory>
+    </None>
+    <None Update="Transcriptomics\TestData\20mer1.fasta.gz">
+      <CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory>
+    </None>
+    <None Update="Transcriptomics\TestData\20mer1.xml">
+      <CopyToOutputDirectory>Always</CopyToOutputDirectory>
+    </None>
+    <None Update="Transcriptomics\TestData\20mer1.xml.gz">
+      <CopyToOutputDirectory>Always</CopyToOutputDirectory>
+    </None>
+    <None Update="Transcriptomics\TestData\ModomicsUnmodifiedTrimmed.fasta">
+      <CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory>
+    </None>
+    <None Update="Transcriptomics\TestData\ModomicsUnmodifiedTrimmed.fasta.gz">
+      <CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory>
     </None>
 	<None Update="DataFiles\centroid_1x_MS1_4x_autoMS2.d\**">
 		  <CopyToOutputDirectory>Always</CopyToOutputDirectory>

mzLib/Test/Transcriptomics/TestData/20mer1.fasta

@@ -0,0 +1,2 @@
+>id:2|Name:20mer1|SOterm:20mer1|Type:tRNA|Subtype:Ala|Feature:VGC|Cellular_Localization:freezer|Species:standard
+GUACUGCCUCUAGUGAAGCA

mzLib/Test/Transcriptomics/TestData/20mer1.xml

@@ -0,0 +1,17 @@
+<?xml version="1.0" encoding="utf-8"?>
+<mzLibProteinDb>
+  <entry>
+    <accession>20mer1</accession>
+    <name>20mer1</name>
+    <protein>
+      <recommendedName>
+        <fullName>20mer1</fullName>
+      </recommendedName>
+    </protein>
+    <gene />
+    <organism>
+      <name type="scientific">standard</name>
+    </organism>
+    <sequence length="20">GUACUGCCUCUAGUGAAGCA</sequence>
+  </entry>
+</mzLibProteinDb>

mzLib/Test/Transcriptomics/TestData/ModomicsUnmodifiedTrimmed.fasta

@@ -0,0 +1,10 @@
+>id:1|Name:tdbR00000010|SOterm:SO:0000254|Type:tRNA|Subtype:Ala|Feature:VGC|Cellular_Localization:prokaryotic cytosol|Species:Escherichia coli
+GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA
+>id:2|Name:tdbR00000008|SOterm:SO:0000254|Type:tRNA|Subtype:Ala|Feature:GGC|Cellular_Localization:prokaryotic cytosol|Species:Escherichia coli
+GGGGCUAUAGCUCAGCUGGGAGAGCGCUUGCAUGGCAUGCAAGAGGUCAGCGGUUCGAUCCCGCUUAGCUCCACCA
+>id:3|Name:tdbR00000356|SOterm:SO:0001036|Type:tRNA|Subtype:Arg|Feature:ICG|Cellular_Localization:prokaryotic cytosol|Species:Escherichia coli
+GCAUCCGUAGCUCAGCUGGAUAGAGUACUCGGCUACGAACCGAGCGGUCGGAGGUUCGAAUCCUCCCGGAUGCACCA
+>id:4|Name:tdbR00000359|SOterm:SO:0001036|Type:tRNA|Subtype:Arg|Feature:CCG|Cellular_Localization:prokaryotic cytosol|Species:Escherichia coli
+GCGCCCGUAGCUCAGCUGGAUAGAGCGCUGCCCUCCGGAGGCAGAGGUCUCAGGUUCGAAUCCUGUCGGGCGCGCCA
+>id:5|Name:tdbR00000358|SOterm:SO:0001036|Type:tRNA|Subtype:Arg|Feature:UCU|Cellular_Localization:prokaryotic cytosol|Species:Escherichia coli
+GCGCCCUUAGCUCAGUUGGAUAGAGCAACGACCUUCUAAGUCGUGGGCCGCAGGUUCGAAUCCUGCAGGGCGCGCCA