import shaker.rna_tools.rna_io as rio
import shaker.simushape as sim
# Train a model
data = rio.get_all_data("data/RNA16.react","data/RNA16.dbn")
model = sim.make_model(data,data.keys())
# Predict
print (sim.predict(model,"AAAAAAGGGGCCCCCCCGGGGGUUUUUU"))
To train a simple model you can also type 'shaker' in your commandline and look at the instructions.
# get vienna RNA binaries via conda or their ppa:
# https://repo.anaconda.com/miniconda/Miniconda2-latest-Linux-x86_64.sh
#conda config --add channels defaults
#conda config --add channels bioconda
#conda config --add channels conda-forge
conda install viennarna
pip install shaker-rna
www.chem.unc.edu/rna/data-files/mustoe_2018_DATA_SOFTWARE.zip
We added this data in shaker readable format unter /data/weeks194_orig/
outdated