Test profile not working

[nschcolnicov]

I recently tried running the test profile using docker and singularity and they both fail for different reasons:
Singularity command:
nextflow run ../../main.nf -profile test,singularity --outdir results
nextflow log: singularity.log

Docker command:
nextflow run ../../main.nf -profile test,docker --outdir results -resume

nextflow log: docker.log

Run details:
Branch: dev, commit: 374ec02

More info:
Test profile seems to be working in master.

Related issues:
#367

FYI @apeltzer @atrigila @grst

Tasks

Preview Give feedback

1. Default test profile causes pipeline failure #373
   +0
   
2. FIx test profile not working with singularity
3. Add Illumina config to test profiles so that they match CI tests #375
   +0
   

[nschcolnicov]

For the first docker command, the issue seems to be related to having the params protocol set to "Custom" while the MIRTRACE_RUN process expects "custom"

[atrigila]

The docker command can be solved with adding the 'illumina' profile.

nextflow run ../../main.nf -profile test,illumina,docker --outdir results -resume

I will make a PR for this issue.

[nschcolnicov]

Seems that the original singularity issue was related with running the command in gitpod, if I run this command on a different environment, I get this issue:

Caused by:
  Process `NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (Clone9_N2)` terminated with an error exit status (255)

Command executed:

  [ ! -f  Clone9_N2.fastq.gz ] && ln -sf C9-N2-R1_S8_L001_R1_001.fastq.gz Clone9_N2.fastq.gz
  
  fastp \
      --in1 Clone9_N2.fastq.gz \
      --out1  Clone9_N2.fastp.fastq.gz \
      --thread 2 \
      --json Clone9_N2.fastp.json \
      --html Clone9_N2.fastp.html \
      --adapter_fasta known_adapters.fa \
       \
      -l 17 --max_len1 100 --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
      2> >(tee Clone9_N2.fastp.log >&2)
  
  cat <<-END_VERSIONS > versions.yml
  "NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP":
      fastp: $(fastp --version 2>&1 | sed -e "s/fastp //g")
  END_VERSIONS

Command exit status:
  255

Command output:
  (empty)

Command error:
  WARNING: While bind mounting '/scratch/nextflow/work/schcolni/82/125ce346804217781ff2d6cd5841aa:/scratch/nextflow/work/schcolni/82/125ce346804217781ff2d6cd5841aa': destination is already in the mount point list
  ERROR: sequence and quality have different length:
  @M07660:69:000000000-KDJ4R:1:1114:2947:1908HEGAFAFF1G
  @M076ACTCTTAGCGGTGGATCACTCGGCTCGTGC
  +
  BBBBBBBBBBFFGGGGGGGGGGHHHHHGGGGGGGHG
  ERROR: sequence and quality have different length

Work dir:
  /scratch/nextflow/work/schcolni/82/125ce346804217781ff2d6cd5841aa

Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named `.command.sh`

 -- Check '.nextflow.log' file for details
ERROR ~ Pipeline failed. Please refer to troubleshooting docs: https://nf-co.re/docs/usage/troubleshooting

 -- Check '.nextflow.log' file for details```

[nschcolnicov]

The run with singularity seems to be working now, probably the issue was with the running environment: